Search for Variation information by Variation ID:
Detailed information for vg0510324989:
| Variant ID: vg0510324989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 10324989 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AAAATCAACGCCATCCTCAGCATGAAACCGCCAAGCTCCCAAAAGGACGTCCAAAAGCTGACTGGTTGCATGGTGGCGCTCAGCCGGTTCGTCTCACGAC[T/A]
CGGCGAGCGGGGGATGCCCTTCTTCAAGTTGCTGAAGAAGACTGACAATTTCCAGTGGGGACCCGAAGCACAGAAAGCCTTTGAAGACTTCAAGAAACTT
Reverse complement sequence
AAGTTTCTTGAAGTCTTCAAAGGCTTTCTGTGCTTCGGGTCCCCACTGGAAATTGTCAGTCTTCTTCAGCAACTTGAAGAAGGGCATCCCCCGCTCGCCG[A/T]
GTCGTGAGACGAACCGGCTGAGCGCCACCATGCAACCAGTCAGCTTTTGGACGTCCTTTTGGGAGCTTGGCGGTTTCATGCTGAGGATGGCGTTGATTTT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 90.30% | 9.60% | 0.11% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 8.50% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 22.70% | 77.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica III | 913 | 82.10% | 17.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 91.20% | 8.70% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0510324989 | T -> A | LOC_Os05g17960.1 | missense_variant ; p.Leu1049His; MODERATE | nonsynonymous_codon ; L1049H | Average:39.536; most accessible tissue: Zhenshan97 flag leaf, score: 61.926 | probably damaging  |
3.324 |
DELETERIOUS | 0.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0510324989 | NA | 2.58E-06 | mr1654 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | 9.75E-06 | NA | mr1147_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | 1.76E-07 | NA | mr1316_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | 6.33E-06 | NA | mr1318_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | 5.91E-06 | NA | mr1526_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | NA | 4.06E-12 | mr1610_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | NA | 3.37E-06 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | 3.44E-06 | NA | mr1788_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | 8.57E-06 | NA | mr1932_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0510324989 | NA | 1.35E-14 | mr1936_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |