\
| Variant ID: vg0509887388 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9887388 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 93. )
TACCGAGGGCCGGAACAACCGGTTGTTTTCTTTGCTCCCCCAACCTCTGTCGGTAGTTCAGAACTTCATCAGATAGGACTGTCAGAAATCCCCATCGTCA[G/A]
AGGGTTCGGAGACGTGTTTCCGGAAGAACTACCCGGTATGCCACCGAAGCGAGAGATTGAGTTCCGGATAGATCTTGCTCCAGGAACCACTCCCCAGTAC
GTACTGGGGAGTGGTTCCTGGAGCAAGATCTATCCGGAACTCAATCTCTCGCTTCGGTGGCATACCGGGTAGTTCTTCCGGAAACACGTCTCCGAACCCT[C/T]
TGACGATGGGGATTTCTGACAGTCCTATCTGATGAAGTTCTGAACTACCGACAGAGGTTGGGGGAGCAAAGAAAACAACCGGTTGTTCCGGCCCTCGGTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 91.60% | 5.60% | 1.06% | 1.74% | NA |
| All Indica | 2759 | 87.10% | 9.40% | 1.27% | 2.17% | NA |
| All Japonica | 1512 | 99.70% | 0.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.90% | 0.00% | 0.00% | 1.12% | NA |
| Indica I | 595 | 96.80% | 1.20% | 0.50% | 1.51% | NA |
| Indica II | 465 | 74.60% | 23.20% | 1.94% | 0.22% | NA |
| Indica III | 913 | 80.50% | 13.10% | 1.64% | 4.71% | NA |
| Indica Intermediate | 786 | 94.90% | 3.20% | 1.02% | 0.89% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.00% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 70.80% | 0.00% | 11.46% | 17.71% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 1.11% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509887388 | G -> DEL | LOC_Os05g17270.1 | N | frameshift_variant | Average:43.76; most accessible tissue: Minghui63 flag leaf, score: 74.563 | N | N | N | N |
| vg0509887388 | G -> A | LOC_Os05g17270.1 | missense_variant ; p.Arg766Lys; MODERATE | nonsynonymous_codon ; R766K | Average:43.76; most accessible tissue: Minghui63 flag leaf, score: 74.563 | benign |
1.188 |
DELETERIOUS | 0.05 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509887388 | 2.43E-15 | 1.77E-40 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 1.49E-10 | 6.05E-23 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 1.43E-07 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 3.01E-06 | 5.87E-10 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 1.83E-18 | 1.28E-43 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 2.03E-12 | 6.98E-24 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 5.33E-07 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 4.14E-06 | NA | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | NA | 7.56E-08 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 1.60E-15 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509887388 | 6.92E-12 | 1.72E-18 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |