\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0509755928:

Variant ID: vg0509755928 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 9755928
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


CTTATCAGGGATGGATCTTTCTAGCTATGATTTTATTAGTATCTCCAATGGCAAATTTGTACCCATCTCTGTAAAGCTGGCTAGTTTAGCACGGCTTGGC[C/T]
ATATCAATTTGTGTAATGAGTAAAGAAGCTAGTTTAGAGTGGTTGCAAAAGAGGGTGCAAGAATATCGGTCTACAAAGAACGATATTGGTAAGACTACTG

Reverse complement sequence

CAGTAGTCTTACCAATATCGTTCTTTGTAGACCGATATTCTTGCACCCTCTTTTGCAACCACTCTAAACTAGCTTCTTTACTCATTACACAAATTGATAT[G/A]
GCCAAGCCGTGCTAAACTAGCCAGCTTTACAGAGATGGGTACAAATTTGCCATTGGAGATACTAATAAAATCATAGCTAGAAAGATCCATCCCTGATAAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.30% 2.30% 0.36% 0.00% NA
All Indica  2759 99.70% 0.10% 0.11% 0.00% NA
All Japonica  1512 92.10% 7.10% 0.86% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.20% 0.50% 0.25% 0.00% NA
Temperate Japonica  767 98.20% 1.60% 0.26% 0.00% NA
Tropical Japonica  504 84.90% 13.50% 1.59% 0.00% NA
Japonica Intermediate  241 87.60% 11.20% 1.24% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0509755928 C -> T LOC_Os05g17090.1 upstream_gene_variant ; 16.0bp to feature; MODIFIER silent_mutation Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0509755928 C -> T LOC_Os05g17080.1 downstream_gene_variant ; 3553.0bp to feature; MODIFIER silent_mutation Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N
vg0509755928 C -> T LOC_Os05g17080-LOC_Os05g17090 intergenic_region ; MODIFIER silent_mutation Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0509755928 NA 3.45E-07 mr1236 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 3.15E-07 7.21E-14 mr1301 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 1.10E-06 9.43E-13 mr1410 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 NA 1.23E-07 mr1676 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 NA 4.89E-15 mr1769 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 NA 1.48E-13 mr1951 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 3.66E-06 NA mr1301_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 5.95E-06 3.58E-12 mr1410_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 NA 2.44E-08 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 NA 7.03E-18 mr1769_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928 NA 3.31E-06 mr1951_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251