\
| Variant ID: vg0509755928 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9755928 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )
CTTATCAGGGATGGATCTTTCTAGCTATGATTTTATTAGTATCTCCAATGGCAAATTTGTACCCATCTCTGTAAAGCTGGCTAGTTTAGCACGGCTTGGC[C/T]
ATATCAATTTGTGTAATGAGTAAAGAAGCTAGTTTAGAGTGGTTGCAAAAGAGGGTGCAAGAATATCGGTCTACAAAGAACGATATTGGTAAGACTACTG
CAGTAGTCTTACCAATATCGTTCTTTGTAGACCGATATTCTTGCACCCTCTTTTGCAACCACTCTAAACTAGCTTCTTTACTCATTACACAAATTGATAT[G/A]
GCCAAGCCGTGCTAAACTAGCCAGCTTTACAGAGATGGGTACAAATTTGCCATTGGAGATACTAATAAAATCATAGCTAGAAAGATCCATCCCTGATAAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.30% | 2.30% | 0.36% | 0.00% | NA |
| All Indica | 2759 | 99.70% | 0.10% | 0.11% | 0.00% | NA |
| All Japonica | 1512 | 92.10% | 7.10% | 0.86% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.20% | 0.50% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.60% | 0.26% | 0.00% | NA |
| Tropical Japonica | 504 | 84.90% | 13.50% | 1.59% | 0.00% | NA |
| Japonica Intermediate | 241 | 87.60% | 11.20% | 1.24% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509755928 | C -> T | LOC_Os05g17090.1 | upstream_gene_variant ; 16.0bp to feature; MODIFIER | silent_mutation | Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| vg0509755928 | C -> T | LOC_Os05g17080.1 | downstream_gene_variant ; 3553.0bp to feature; MODIFIER | silent_mutation | Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| vg0509755928 | C -> T | LOC_Os05g17080-LOC_Os05g17090 | intergenic_region ; MODIFIER | silent_mutation | Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509755928 | NA | 3.45E-07 | mr1236 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | 3.15E-07 | 7.21E-14 | mr1301 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | 1.10E-06 | 9.43E-13 | mr1410 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | NA | 1.23E-07 | mr1676 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | NA | 4.89E-15 | mr1769 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | NA | 1.48E-13 | mr1951 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | 3.66E-06 | NA | mr1301_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | 5.95E-06 | 3.58E-12 | mr1410_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | NA | 2.44E-08 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | NA | 7.03E-18 | mr1769_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509755928 | NA | 3.31E-06 | mr1951_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |