Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0509755928:

Variant ID: vg0509755928 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 9755928
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

CTTATCAGGGATGGATCTTTCTAGCTATGATTTTATTAGTATCTCCAATGGCAAATTTGTACCCATCTCTGTAAAGCTGGCTAGTTTAGCACGGCTTGGC[C/T]
ATATCAATTTGTGTAATGAGTAAAGAAGCTAGTTTAGAGTGGTTGCAAAAGAGGGTGCAAGAATATCGGTCTACAAAGAACGATATTGGTAAGACTACTG

Reverse complement sequence

CAGTAGTCTTACCAATATCGTTCTTTGTAGACCGATATTCTTGCACCCTCTTTTGCAACCACTCTAAACTAGCTTCTTTACTCATTACACAAATTGATAT[G/A]
GCCAAGCCGTGCTAAACTAGCCAGCTTTACAGAGATGGGTACAAATTTGCCATTGGAGATACTAATAAAATCATAGCTAGAAAGATCCATCCCTGATAAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.30%	2.30%	0.36%	0.00%	NA
All Indica	2759	99.70%	0.10%	0.11%	0.00%	NA
All Japonica	1512	92.10%	7.10%	0.86%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.00%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.20%	0.50%	0.25%	0.00%	NA
Temperate Japonica	767	98.20%	1.60%	0.26%	0.00%	NA
Tropical Japonica	504	84.90%	13.50%	1.59%	0.00%	NA
Japonica Intermediate	241	87.60%	11.20%	1.24%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	98.90%	0.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0509755928	C -> T	LOC_Os05g17090.1	upstream_gene_variant ; 16.0bp to feature; MODIFIER	silent_mutation	Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg0509755928	C -> T	LOC_Os05g17080.1	downstream_gene_variant ; 3553.0bp to feature; MODIFIER	silent_mutation	Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N
vg0509755928	C -> T	LOC_Os05g17080-LOC_Os05g17090	intergenic_region ; MODIFIER	silent_mutation	Average:40.0; most accessible tissue: Zhenshan97 young leaf, score: 71.923	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0509755928	NA	3.45E-07	mr1236	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	3.15E-07	7.21E-14	mr1301	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	1.10E-06	9.43E-13	mr1410	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	NA	1.23E-07	mr1676	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	NA	4.89E-15	mr1769	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	NA	1.48E-13	mr1951	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	3.66E-06	NA	mr1301_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	5.95E-06	3.58E-12	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	NA	2.44E-08	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	NA	7.03E-18	mr1769_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509755928	NA	3.31E-06	mr1951_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251