\
| Variant ID: vg0509650627 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9650627 |
| Reference Allele: T | Alternative Allele: G |
| Primary Allele: T | Secondary Allele: G |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, others allele: 0.00, population size: 313. )
ACTAAATTTTGTTATGGGCAGATATATTGTTGTACAGGATAACACTTCAATCTTTCAATAACAGGTACATCGATAGTTGTGGATTCAGTGGTCCGTTCCC[T/G]
TCAACATTCTCAAAACTTCAGAACCTGAAGATCTTGTACGGTCAATACCATAGCCTTAGACATTATATATGTTCGTCATGTTTTCATGCTAAATGTCTAA
TTAGACATTTAGCATGAAAACATGACGAACATATATAATGTCTAAGGCTATGGTATTGACCGTACAAGATCTTCAGGTTCTGAAGTTTTGAGAATGTTGA[A/C]
GGGAACGGACCACTGAATCCACAACTATCGATGTACCTGTTATTGAAAGATTGAAGTGTTATCCTGTACAACAATATATCTGCCCATAACAAAATTTAGT
| Populations | Population Size | Frequency of T(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.50% | 5.60% | 0.89% | 0.00% | NA |
| All Indica | 2759 | 89.10% | 9.50% | 1.45% | 0.00% | NA |
| All Japonica | 1512 | 99.80% | 0.10% | 0.13% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 1.00% | 1.01% | 0.00% | NA |
| Indica II | 465 | 71.60% | 24.70% | 3.66% | 0.00% | NA |
| Indica III | 913 | 86.70% | 13.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 2.80% | 1.91% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.10% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 99.80% | 0.00% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509650627 | T -> G | LOC_Os05g16930.1 | synonymous_variant ; p.Pro140Pro; LOW | synonymous_codon | Average:59.743; most accessible tissue: Zhenshan97 young leaf, score: 71.497 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509650627 | 8.07E-14 | 7.46E-39 | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 3.57E-10 | 1.80E-22 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 8.29E-07 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 6.01E-06 | 1.39E-09 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 2.69E-16 | 1.97E-40 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 6.49E-12 | 6.32E-23 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | NA | 8.80E-06 | mr1159_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 2.02E-06 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 8.41E-06 | NA | mr1514_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 8.43E-14 | NA | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509650627 | 5.06E-12 | 5.04E-18 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |