\
| Variant ID: vg0509447947 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9447947 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 128. )
GAGTTAATTACTTCTTAGTCTTGGTGACAGAAGAAATAGGTCTTTGAACTTTTGGATGAAGGGAGTATATAATAATATCAATGAATACATGTTTTTGTTA[A/G]
AGTATTTTATAAGACTAGTCATATGGTTTCATATATGTAAGATAAAATATTTTAGATATTATTTGTAGTTAAAGGTTTTAAATTTTAACCATAGCCTTGT
ACAAGGCTATGGTTAAAATTTAAAACCTTTAACTACAAATAATATCTAAAATATTTTATCTTACATATATGAAACCATATGACTAGTCTTATAAAATACT[T/C]
TAACAAAAACATGTATTCATTGATATTATTATATACTCCCTTCATCCAAAAGTTCAAAGACCTATTTCTTCTGTCACCAAGACTAAGAAGTAATTAACTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.10% | 2.40% | 0.49% | 0.00% | NA |
| All Indica | 2759 | 95.10% | 4.00% | 0.83% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.00% | 0.00% | 1.01% | 0.00% | NA |
| Indica II | 465 | 76.30% | 20.90% | 2.80% | 0.00% | NA |
| Indica III | 913 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.70% | 0.51% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509447947 | A -> G | LOC_Os05g16660.1 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:58.265; most accessible tissue: Callus, score: 82.632 | N | N | N | N |
| vg0509447947 | A -> G | LOC_Os05g16660.2 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:58.265; most accessible tissue: Callus, score: 82.632 | N | N | N | N |
| vg0509447947 | A -> G | LOC_Os05g16660.3 | upstream_gene_variant ; 853.0bp to feature; MODIFIER | silent_mutation | Average:58.265; most accessible tissue: Callus, score: 82.632 | N | N | N | N |
| vg0509447947 | A -> G | LOC_Os05g16640.1 | downstream_gene_variant ; 4266.0bp to feature; MODIFIER | silent_mutation | Average:58.265; most accessible tissue: Callus, score: 82.632 | N | N | N | N |
| vg0509447947 | A -> G | LOC_Os05g16640-LOC_Os05g16660 | intergenic_region ; MODIFIER | silent_mutation | Average:58.265; most accessible tissue: Callus, score: 82.632 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509447947 | 8.09E-12 | 1.64E-38 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 3.25E-08 | 7.42E-22 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | NA | 3.80E-07 | mr1133 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | NA | 3.27E-06 | mr1269 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | NA | 6.72E-08 | mr1399 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 6.13E-07 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 7.92E-06 | 1.09E-09 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | NA | 7.85E-07 | mr1667 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | NA | 8.07E-06 | mr1976 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 1.91E-16 | 1.33E-43 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 8.96E-11 | 3.49E-24 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | NA | 5.81E-06 | mr1428_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 3.55E-06 | NA | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 2.07E-16 | 2.12E-32 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509447947 | 2.26E-12 | 9.67E-20 | mr1632_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |