\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0509447947:

Variant ID: vg0509447947 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 9447947
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 128. )

Flanking Sequence (100 bp) in Reference Genome:


GAGTTAATTACTTCTTAGTCTTGGTGACAGAAGAAATAGGTCTTTGAACTTTTGGATGAAGGGAGTATATAATAATATCAATGAATACATGTTTTTGTTA[A/G]
AGTATTTTATAAGACTAGTCATATGGTTTCATATATGTAAGATAAAATATTTTAGATATTATTTGTAGTTAAAGGTTTTAAATTTTAACCATAGCCTTGT

Reverse complement sequence

ACAAGGCTATGGTTAAAATTTAAAACCTTTAACTACAAATAATATCTAAAATATTTTATCTTACATATATGAAACCATATGACTAGTCTTATAAAATACT[T/C]
TAACAAAAACATGTATTCATTGATATTATTATATACTCCCTTCATCCAAAAGTTCAAAGACCTATTTCTTCTGTCACCAAGACTAAGAAGTAATTAACTC

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.10% 2.40% 0.49% 0.00% NA
All Indica  2759 95.10% 4.00% 0.83% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.00% 0.00% 1.01% 0.00% NA
Indica II  465 76.30% 20.90% 2.80% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.70% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0509447947 A -> G LOC_Os05g16660.1 upstream_gene_variant ; 853.0bp to feature; MODIFIER silent_mutation Average:58.265; most accessible tissue: Callus, score: 82.632 N N N N
vg0509447947 A -> G LOC_Os05g16660.2 upstream_gene_variant ; 853.0bp to feature; MODIFIER silent_mutation Average:58.265; most accessible tissue: Callus, score: 82.632 N N N N
vg0509447947 A -> G LOC_Os05g16660.3 upstream_gene_variant ; 853.0bp to feature; MODIFIER silent_mutation Average:58.265; most accessible tissue: Callus, score: 82.632 N N N N
vg0509447947 A -> G LOC_Os05g16640.1 downstream_gene_variant ; 4266.0bp to feature; MODIFIER silent_mutation Average:58.265; most accessible tissue: Callus, score: 82.632 N N N N
vg0509447947 A -> G LOC_Os05g16640-LOC_Os05g16660 intergenic_region ; MODIFIER silent_mutation Average:58.265; most accessible tissue: Callus, score: 82.632 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0509447947 8.09E-12 1.64E-38 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 3.25E-08 7.42E-22 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 NA 3.80E-07 mr1133 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 NA 3.27E-06 mr1269 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 NA 6.72E-08 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 6.13E-07 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 7.92E-06 1.09E-09 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 NA 7.85E-07 mr1667 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 NA 8.07E-06 mr1976 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 1.91E-16 1.33E-43 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 8.96E-11 3.49E-24 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 NA 5.81E-06 mr1428_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 3.55E-06 NA mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 2.07E-16 2.12E-32 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509447947 2.26E-12 9.67E-20 mr1632_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251