\
| Variant ID: vg0509418232 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9418232 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TTATATGCTAATTAAGTCTAATTACAAATCTAATAATCTTAATTGCATTACAAATATAACAATCATATATATATATATATATAATTACGTCACTTGCCTG[C/G]
GCGAATTCCTTCGAGGGCTAGCTCTACCACTCCGGCTTGAGGGACGACTCCAACAACGTCTTTTCTGCAAGATACAAAAAGATGTATTAGCATAAACGCG
CGCGTTTATGCTAATACATCTTTTTGTATCTTGCAGAAAAGACGTTGTTGGAGTCGTCCCTCAAGCCGGAGTGGTAGAGCTAGCCCTCGAAGGAATTCGC[G/C]
CAGGCAAGTGACGTAATTATATATATATATATATATGATTGTTATATTTGTAATGCAATTAAGATTATTAGATTTGTAATTAGACTTAATTAGCATATAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 0.50% | 1.27% | 0.76% | NA |
| All Indica | 2759 | 98.60% | 0.30% | 0.58% | 0.62% | NA |
| All Japonica | 1512 | 98.30% | 0.00% | 0.46% | 1.19% | NA |
| Aus | 269 | 81.00% | 5.20% | 13.75% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.20% | 0.00% | 0.17% | NA |
| Indica II | 465 | 97.60% | 0.00% | 0.65% | 1.72% | NA |
| Indica III | 913 | 99.00% | 0.40% | 0.44% | 0.11% | NA |
| Indica Intermediate | 786 | 97.70% | 0.30% | 1.15% | 0.89% | NA |
| Temperate Japonica | 767 | 97.50% | 0.00% | 0.39% | 2.09% | NA |
| Tropical Japonica | 504 | 99.20% | 0.00% | 0.60% | 0.20% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.00% | 0.41% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509418232 | C -> DEL | N | N | silent_mutation | Average:26.453; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0509418232 | C -> G | LOC_Os05g16600.1 | downstream_gene_variant ; 4099.0bp to feature; MODIFIER | silent_mutation | Average:26.453; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0509418232 | C -> G | LOC_Os05g16620.1 | downstream_gene_variant ; 1494.0bp to feature; MODIFIER | silent_mutation | Average:26.453; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| vg0509418232 | C -> G | LOC_Os05g16610.1 | intron_variant ; MODIFIER | silent_mutation | Average:26.453; most accessible tissue: Minghui63 panicle, score: 50.413 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509418232 | NA | 2.69E-06 | mr1080 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509418232 | NA | 2.04E-06 | mr1140 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509418232 | 9.92E-07 | NA | mr1178 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509418232 | NA | 1.38E-06 | mr1203 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509418232 | 2.48E-06 | 1.20E-07 | mr1395 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509418232 | NA | 6.28E-07 | mr1618 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |