Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0509233251:

Variant ID: vg0509233251 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 9233251
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGCAGCAGGTGGCTGTCCTCGAGGCGGACGAGCAGCCCCGTCCTCTGGCTGAAGTAGCCGAGCACGGCGTGCCGGACCACCTCGACGTCGCCGCTGCTC[C/T]
GGGCGCGCAGCGCGGCGTGGTCGGCGTCGACGCGGAGCACGAAGCAGTCGTCGCCGTCGACGCACCTCTCGCCCACCCACGCCGCGCTCGAGAACAGGTC

Reverse complement sequence

GACCTGTTCTCGAGCGCGGCGTGGGTGGGCGAGAGGTGCGTCGACGGCGACGACTGCTTCGTGCTCCGCGTCGACGCCGACCACGCCGCGCTGCGCGCCC[G/A]
GAGCAGCGGCGACGTCGAGGTGGTCCGGCACGCCGTGCTCGGCTACTTCAGCCAGAGGACGGGGCTGCTCGTCCGCCTCGAGGACAGCCACCTGCTGCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.10% 4.50% 1.48% 0.00% NA
All Indica  2759 98.60% 0.60% 0.83% 0.00% NA
All Japonica  1512 84.30% 12.80% 2.91% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 98.50% 0.00% 1.51% 0.00% NA
Indica II  465 97.20% 1.10% 1.72% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.40% 0.76% 0.00% NA
Temperate Japonica  767 96.70% 2.00% 1.30% 0.00% NA
Tropical Japonica  504 65.10% 29.00% 5.95% 0.00% NA
Japonica Intermediate  241 85.10% 13.30% 1.66% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 96.70% 1.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0509233251 C -> T LOC_Os05g16300.1 missense_variant ; p.Arg263Gln; MODERATE nonsynonymous_codon ; R263Q Average:86.773; most accessible tissue: Zhenshan97 root, score: 90.023 benign 0.765 TOLERATED 0.38

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0509233251 C T 0.0 0.01 0.01 0.0 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0509233251 2.62E-07 2.62E-07 mr1159_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.90E-06 7.66E-07 mr1220_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 NA 8.38E-06 mr1263_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 5.88E-06 5.88E-06 mr1286_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 4.45E-06 6.97E-06 mr1289_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 3.97E-06 3.96E-06 mr1312_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 7.26E-07 7.25E-07 mr1335_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 6.43E-06 6.43E-06 mr1412_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.36E-06 1.36E-06 mr1418_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 3.45E-06 1.51E-06 mr1419_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 4.63E-06 1.51E-06 mr1420_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 4.98E-06 4.98E-06 mr1440_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 3.86E-06 2.59E-06 mr1467_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.91E-07 1.91E-07 mr1470_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.87E-06 1.17E-06 mr1488_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.34E-06 1.34E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 2.80E-06 3.64E-07 mr1544_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 2.50E-06 2.95E-06 mr1556_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 2.24E-07 2.00E-07 mr1646_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 3.98E-08 3.46E-07 mr1665_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 NA 2.57E-06 mr1668_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 7.78E-07 7.78E-07 mr1687_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.71E-07 6.29E-08 mr1689_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 1.96E-06 2.53E-06 mr1764_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 2.01E-06 2.01E-06 mr1811_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 8.20E-06 5.32E-06 mr1812_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 2.63E-06 1.99E-06 mr1816_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 5.78E-06 5.78E-06 mr1840_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509233251 4.14E-06 4.14E-06 mr1847_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251