\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0509208793:

Variant ID: vg0509208793 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 9208793
Reference Allele: CAlternative Allele: A
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, A: 0.02, others allele: 0.00, population size: 295. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTAATCTCAGCCTTAACCGGTTCAAGCATATCGGCTTTACATCTCCTCGGAGGTTGCTGGCGTGGTCTAACCCCTGGTTTGATAGGTAGCCGATGTT[C/A]
AACAATCGATCGGCTGAGTCCAGGCATCTCATAATATTCCCAAGCGAAGCAATCTCTAAACTCTTTTAAGTGCTCTATCAGCTTGGTTCTAAACTCTAGA

Reverse complement sequence

TCTAGAGTTTAGAACCAAGCTGATAGAGCACTTAAAAGAGTTTAGAGATTGCTTCGCTTGGGAATATTATGAGATGCCTGGACTCAGCCGATCGATTGTT[G/T]
AACATCGGCTACCTATCAAACCAGGGGTTAGACCACGCCAGCAACCTCCGAGGAGATGTAAAGCCGATATGCTTGAACCGGTTAAGGCTGAGATTAAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.40% 5.10% 0.44% 0.99% NA
All Indica  2759 94.80% 3.80% 0.36% 1.05% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 39.40% 50.20% 3.72% 6.69% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 90.60% 6.10% 0.88% 2.41% NA
Indica Intermediate  786 93.30% 5.60% 0.25% 0.89% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.00% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0509208793 C -> DEL N N silent_mutation Average:37.244; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0509208793 C -> A LOC_Os05g16260.1 downstream_gene_variant ; 2953.0bp to feature; MODIFIER silent_mutation Average:37.244; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N
vg0509208793 C -> A LOC_Os05g16270.1 intron_variant ; MODIFIER silent_mutation Average:37.244; most accessible tissue: Minghui63 flag leaf, score: 57.188 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0509208793 NA 2.34E-08 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 1.70E-08 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 4.81E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 1.25E-08 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 3.23E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 9.56E-07 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 3.43E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 1.45E-07 mr1328 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 3.38E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 7.23E-06 mr1373 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 2.40E-14 mr1499 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 8.96E-06 mr1507 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 4.93E-06 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 1.19E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 8.43E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 8.20E-10 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509208793 NA 6.24E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251