Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0509088193:

Variant ID: vg0509088193 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 9088193
Reference Allele: G	Alternative Allele: C,A
Primary Allele: G	Secondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.95, C: 0.05, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGTGCATTATCGTGTGATCTATCTCCAAGGTTTGTTGTAGATTTTTCAGCCCATGGATTGGATTACCTTCATGTGTCAACCGGAAGTCCCGGTCTACTAA[G/C,A]
GACTTGTATGCTCCAATGGTAAATCTTTTACATCATCTCTACATATACAAGCTTCAAGTGTCATGAATATTCTTTCTTATGGTAGATTGCCATGCATTCA

Reverse complement sequence

TGAATGCATGGCAATCTACCATAAGAAAGAATATTCATGACACTTGAAGCTTGTATATGTAGAGATGATGTAAAAGATTTACCATTGGAGCATACAAGTC[C/G,T]
TTAGTAGACCGGGACTTCCGGTTGACACATGAAGGTAATCCAATCCATGGGCTGAAAAATCTACAACAAACCTTGGAGATAGATCACACGATAATGCACA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.90%	25.00%	0.08%	0.00%	NA
All Indica	2759	64.60%	35.20%	0.14%	0.00%	NA
All Japonica	1512	99.70%	0.30%	0.00%	0.00%	NA
Aus	269	27.90%	72.10%	0.00%	0.00%	NA
Indica I	595	85.20%	14.80%	0.00%	0.00%	NA
Indica II	465	68.40%	31.20%	0.43%	0.00%	NA
Indica III	913	44.80%	55.00%	0.22%	0.00%	NA
Indica Intermediate	786	69.80%	30.20%	0.00%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.60%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	88.90%	11.10%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0509088193	G -> A	LOC_Os05g16080.1	downstream_gene_variant ; 2633.0bp to feature; MODIFIER	N	Average:29.157; most accessible tissue: Callus, score: 44.897	N	N	N	N
vg0509088193	G -> A	LOC_Os05g16080-LOC_Os05g16090	intergenic_region ; MODIFIER	N	Average:29.157; most accessible tissue: Callus, score: 44.897	N	N	N	N
vg0509088193	G -> C	LOC_Os05g16080.1	downstream_gene_variant ; 2633.0bp to feature; MODIFIER	silent_mutation	Average:29.157; most accessible tissue: Callus, score: 44.897	N	N	N	N
vg0509088193	G -> C	LOC_Os05g16080-LOC_Os05g16090	intergenic_region ; MODIFIER	silent_mutation	Average:29.157; most accessible tissue: Callus, score: 44.897	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0509088193	NA	2.96E-28	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509088193	NA	1.28E-12	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509088193	NA	1.64E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509088193	8.13E-10	1.49E-27	mr1039_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509088193	1.92E-07	4.46E-13	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509088193	4.64E-06	NA	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509088193	NA	3.37E-10	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251