\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0509049542:

Variant ID: vg0509049542 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 9049542
Reference Allele: CAlternative Allele: A,T
Primary Allele: CSecondary Allele: A

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


ATCGTGAGCTACCTTTACCATGTACATCATTAAGTAACAGTGAAACATTAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCATGGCTAAGCAATTATAT[C/A,T]
TAATATATCTAGTTGAACCAATATATAAATCCAATTAGTCAAATTATAACCCAAGGTAATCAAGAAATAGGGTAATCAATGCAAATTGGCCATAACAAAG

Reverse complement sequence

CTTTGTTATGGCCAATTTGCATTGATTACCCTATTTCTTGATTACCTTGGGTTATAATTTGACTAATTGGATTTATATATTGGTTCAACTAGATATATTA[G/T,A]
ATATAATTGCTTAGCCATGCTTAGAAACATTAGCACACTATTGGGATAACTAATGTTTCACTGTTACTTAATGATGTACATGGTAAAGGTAGCTCACGAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 18.60% 4.30% 1.76% NA
All Indica  2759 65.30% 24.90% 6.78% 2.97% NA
All Japonica  1512 99.70% 0.20% 0.07% 0.00% NA
Aus  269 29.00% 66.50% 4.46% 0.00% NA
Indica I  595 85.70% 8.10% 4.87% 1.34% NA
Indica II  465 68.20% 22.40% 6.67% 2.80% NA
Indica III  913 46.00% 41.30% 7.67% 5.04% NA
Indica Intermediate  786 70.60% 20.20% 7.25% 1.91% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.20% 0.20% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 88.90% 7.80% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0509049542 C -> T LOC_Os05g16020.1 upstream_gene_variant ; 2822.0bp to feature; MODIFIER N Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0509049542 C -> T LOC_Os05g16030.1 downstream_gene_variant ; 4368.0bp to feature; MODIFIER N Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0509049542 C -> T LOC_Os05g16010-LOC_Os05g16020 intergenic_region ; MODIFIER N Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0509049542 C -> DEL N N silent_mutation Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0509049542 C -> A LOC_Os05g16020.1 upstream_gene_variant ; 2822.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0509049542 C -> A LOC_Os05g16030.1 downstream_gene_variant ; 4368.0bp to feature; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N
vg0509049542 C -> A LOC_Os05g16010-LOC_Os05g16020 intergenic_region ; MODIFIER silent_mutation Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0509049542 NA 2.59E-30 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542 NA 1.51E-15 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542 4.76E-07 NA mr1632 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542 NA 2.03E-11 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542 NA 1.34E-27 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542 NA 6.38E-14 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0509049542 NA 4.83E-11 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251