\
| Variant ID: vg0509049542 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 9049542 |
| Reference Allele: C | Alternative Allele: A,T |
| Primary Allele: C | Secondary Allele: A |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 241. )
ATCGTGAGCTACCTTTACCATGTACATCATTAAGTAACAGTGAAACATTAGTTATCCCAATAGTGTGCTAATGTTTCTAAGCATGGCTAAGCAATTATAT[C/A,T]
TAATATATCTAGTTGAACCAATATATAAATCCAATTAGTCAAATTATAACCCAAGGTAATCAAGAAATAGGGTAATCAATGCAAATTGGCCATAACAAAG
CTTTGTTATGGCCAATTTGCATTGATTACCCTATTTCTTGATTACCTTGGGTTATAATTTGACTAATTGGATTTATATATTGGTTCAACTAGATATATTA[G/T,A]
ATATAATTGCTTAGCCATGCTTAGAAACATTAGCACACTATTGGGATAACTAATGTTTCACTGTTACTTAATGATGTACATGGTAAAGGTAGCTCACGAT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 75.40% | 18.60% | 4.30% | 1.76% | NA |
| All Indica | 2759 | 65.30% | 24.90% | 6.78% | 2.97% | NA |
| All Japonica | 1512 | 99.70% | 0.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 29.00% | 66.50% | 4.46% | 0.00% | NA |
| Indica I | 595 | 85.70% | 8.10% | 4.87% | 1.34% | NA |
| Indica II | 465 | 68.20% | 22.40% | 6.67% | 2.80% | NA |
| Indica III | 913 | 46.00% | 41.30% | 7.67% | 5.04% | NA |
| Indica Intermediate | 786 | 70.60% | 20.20% | 7.25% | 1.91% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.20% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 88.90% | 7.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0509049542 | C -> T | LOC_Os05g16020.1 | upstream_gene_variant ; 2822.0bp to feature; MODIFIER | N | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0509049542 | C -> T | LOC_Os05g16030.1 | downstream_gene_variant ; 4368.0bp to feature; MODIFIER | N | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0509049542 | C -> T | LOC_Os05g16010-LOC_Os05g16020 | intergenic_region ; MODIFIER | N | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0509049542 | C -> DEL | N | N | silent_mutation | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0509049542 | C -> A | LOC_Os05g16020.1 | upstream_gene_variant ; 2822.0bp to feature; MODIFIER | silent_mutation | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0509049542 | C -> A | LOC_Os05g16030.1 | downstream_gene_variant ; 4368.0bp to feature; MODIFIER | silent_mutation | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| vg0509049542 | C -> A | LOC_Os05g16010-LOC_Os05g16020 | intergenic_region ; MODIFIER | silent_mutation | Average:33.859; most accessible tissue: Minghui63 flag leaf, score: 50.629 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0509049542 | NA | 2.59E-30 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509049542 | NA | 1.51E-15 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509049542 | 4.76E-07 | NA | mr1632 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509049542 | NA | 2.03E-11 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509049542 | NA | 1.34E-27 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509049542 | NA | 6.38E-14 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0509049542 | NA | 4.83E-11 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |