\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508401535:

Variant ID: vg0508401535 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8401535
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


GATAGCAATTTATTTTTTGTATATGATATTTTTACACTTAAAACATTTGCATATTTAAATAGTTCAAACTTTTGTTCGGCATCAAATAATTATGTCATTT[T/C]
ATGAGGCTCAGTTCTTTCGTAGAACCAATCGACGACGAAACTCCCCAAGAGCCCAAATGGGGAATAAATTGCGATAATTGCTGTAATTGAAATAAATGGA

Reverse complement sequence

TCCATTTATTTCAATTACAGCAATTATCGCAATTTATTCCCCATTTGGGCTCTTGGGGAGTTTCGTCGTCGATTGGTTCTACGAAAGAACTGAGCCTCAT[A/G]
AAATGACATAATTATTTGATGCCGAACAAAAGTTTGAACTATTTAAATATGCAAATGTTTTAAGTGTAAAAATATCATATACAAAAAATAAATTGCTATC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.20% 10.10% 6.75% 0.00% NA
All Indica  2759 94.50% 0.90% 4.68% 0.00% NA
All Japonica  1512 58.50% 29.50% 12.04% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 84.50% 2.00% 13.45% 0.00% NA
Indica II  465 93.10% 1.70% 5.16% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 96.40% 0.40% 3.18% 0.00% NA
Temperate Japonica  767 30.90% 54.50% 14.60% 0.00% NA
Tropical Japonica  504 90.70% 2.00% 7.34% 0.00% NA
Japonica Intermediate  241 78.80% 7.50% 13.69% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 87.80% 6.70% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508401535 T -> C LOC_Os05g14790.1 upstream_gene_variant ; 1705.0bp to feature; MODIFIER silent_mutation Average:43.467; most accessible tissue: Callus, score: 56.211 N N N N
vg0508401535 T -> C LOC_Os05g14790-LOC_Os05g14800 intergenic_region ; MODIFIER silent_mutation Average:43.467; most accessible tissue: Callus, score: 56.211 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508401535 NA 2.26E-07 mr1026 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 1.71E-10 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 2.01E-06 2.01E-06 mr1261 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 5.03E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 6.38E-06 mr1380 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 1.22E-06 mr1555 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 3.55E-26 mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 2.51E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 7.78E-11 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 1.07E-06 mr1937 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 5.57E-06 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 2.35E-07 mr1977 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 2.61E-06 mr1977 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 1.70E-08 9.65E-37 mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 1.54E-12 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 1.68E-06 3.37E-26 mr1617_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508401535 NA 1.99E-09 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251