Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508367063:

Variant ID: vg0508367063 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 8367063
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:

GGGAGGAGAAAAAGACTTGTCGGTTACTAGAGGTTAAGGCTGCGCATGTAAAGGCAAAGGAGAGGAACGATGGTGGTTCATGGAGAAAGAGCAGTGATGG[C/T]
GGTGCGTAGAGTGGCAGTTAGCGGTTGCTGGTGGTACGAGGAATTTGTTATCGACACAATCGTTTAATTTTTTCCTAACTATTGATGATACATGGGTCAC

Reverse complement sequence

GTGACCCATGTATCATCAATAGTTAGGAAAAAATTAAACGATTGTGTCGATAACAAATTCCTCGTACCACCAGCAACCGCTAACTGCCACTCTACGCACC[G/A]
CCATCACTGCTCTTTCTCCATGAACCACCATCGTTCCTCTCCTTTGCCTTTACATGCGCAGCCTTAACCTCTAGTAACCGACAAGTCTTTTTCTCCTCCC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	0.60%	6.03%	2.12%	NA
All Indica	2759	85.10%	1.00%	10.26%	3.62%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	89.10%	0.80%	6.89%	3.19%	NA
Indica II	465	72.70%	2.40%	18.06%	6.88%	NA
Indica III	913	81.40%	1.20%	13.80%	3.61%	NA
Indica Intermediate	786	93.80%	0.10%	4.07%	2.04%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.41%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0508367063	C -> T	LOC_Os05g14730.1	upstream_gene_variant ; 288.0bp to feature; MODIFIER	silent_mutation	Average:56.487; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0508367063	C -> T	LOC_Os05g14730.2	upstream_gene_variant ; 288.0bp to feature; MODIFIER	silent_mutation	Average:56.487; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0508367063	C -> T	LOC_Os05g14720.1	downstream_gene_variant ; 2596.0bp to feature; MODIFIER	silent_mutation	Average:56.487; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0508367063	C -> T	LOC_Os05g14720-LOC_Os05g14730	intergenic_region ; MODIFIER	silent_mutation	Average:56.487; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N
vg0508367063	C -> DEL	N	N	silent_mutation	Average:56.487; most accessible tissue: Minghui63 panicle, score: 71.773	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0508367063	NA	5.04E-11	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508367063	NA	6.80E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508367063	1.35E-06	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508367063	NA	2.40E-12	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508367063	NA	5.17E-06	mr1514_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508367063	2.81E-10	NA	mr1632_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508367063	1.03E-07	1.46E-12	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251