Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508350184:

Variant ID: vg0508350184 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 8350184
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTCTGCGCACTAACCGTAATATACCAGGAATATTTATGCGCCATTGCTGGGATTTATATTTCTATAATGTCGTTAAGAAACACTAACAAACATTTTTGGC[G/A]
CCCTTGCTGGGAAGATTAATAAAGAGATTACTATATGCTACTAACTTTATATTTACCTCTGTATAGTCACTGTCCTTTGCAGGCTAACCTTGTTTTTTTT

Reverse complement sequence

AAAAAAAACAAGGTTAGCCTGCAAAGGACAGTGACTATACAGAGGTAAATATAAAGTTAGTAGCATATAGTAATCTCTTTATTAATCTTCCCAGCAAGGG[C/T]
GCCAAAAATGTTTGTTAGTGTTTCTTAACGACATTATAGAAATATAAATCCCAGCAATGGCGCATAAATATTCCTGGTATATTACGGTTAGTGCGCAGAA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.90%	3.40%	0.63%	7.02%	NA
All Indica	2759	91.50%	2.80%	0.91%	4.82%	NA
All Japonica	1512	94.20%	5.60%	0.00%	0.20%	NA
Aus	269	27.90%	0.00%	1.49%	70.63%	NA
Indica I	595	89.60%	8.60%	1.85%	0.00%	NA
Indica II	465	98.90%	0.40%	0.43%	0.22%	NA
Indica III	913	90.30%	0.00%	0.11%	9.64%	NA
Indica Intermediate	786	89.90%	3.10%	1.40%	5.60%	NA
Temperate Japonica	767	93.10%	6.90%	0.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.20%	0.00%	0.40%	NA
Japonica Intermediate	241	87.10%	12.40%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	91.10%	2.20%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0508350184	G -> DEL	N	N	silent_mutation	Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg0508350184	G -> A	LOC_Os05g14690.1	upstream_gene_variant ; 82.0bp to feature; MODIFIER	silent_mutation	Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N
vg0508350184	G -> A	LOC_Os05g14670-LOC_Os05g14690	intergenic_region ; MODIFIER	silent_mutation	Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0508350184	NA	9.51E-06	mr1909	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	5.88E-06	1.07E-06	mr1349_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	NA	2.09E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	8.58E-06	5.11E-06	mr1452_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	NA	5.57E-06	mr1576_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	NA	4.98E-07	mr1749_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	4.50E-06	4.50E-06	mr1821_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184	NA	6.92E-08	mr1864_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251