\
| Variant ID: vg0508350184 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 8350184 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )
TTCTGCGCACTAACCGTAATATACCAGGAATATTTATGCGCCATTGCTGGGATTTATATTTCTATAATGTCGTTAAGAAACACTAACAAACATTTTTGGC[G/A]
CCCTTGCTGGGAAGATTAATAAAGAGATTACTATATGCTACTAACTTTATATTTACCTCTGTATAGTCACTGTCCTTTGCAGGCTAACCTTGTTTTTTTT
AAAAAAAACAAGGTTAGCCTGCAAAGGACAGTGACTATACAGAGGTAAATATAAAGTTAGTAGCATATAGTAATCTCTTTATTAATCTTCCCAGCAAGGG[C/T]
GCCAAAAATGTTTGTTAGTGTTTCTTAACGACATTATAGAAATATAAATCCCAGCAATGGCGCATAAATATTCCTGGTATATTACGGTTAGTGCGCAGAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.90% | 3.40% | 0.63% | 7.02% | NA |
| All Indica | 2759 | 91.50% | 2.80% | 0.91% | 4.82% | NA |
| All Japonica | 1512 | 94.20% | 5.60% | 0.00% | 0.20% | NA |
| Aus | 269 | 27.90% | 0.00% | 1.49% | 70.63% | NA |
| Indica I | 595 | 89.60% | 8.60% | 1.85% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.40% | 0.43% | 0.22% | NA |
| Indica III | 913 | 90.30% | 0.00% | 0.11% | 9.64% | NA |
| Indica Intermediate | 786 | 89.90% | 3.10% | 1.40% | 5.60% | NA |
| Temperate Japonica | 767 | 93.10% | 6.90% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.20% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 87.10% | 12.40% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 0.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 2.20% | 0.00% | 6.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0508350184 | G -> DEL | N | N | silent_mutation | Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg0508350184 | G -> A | LOC_Os05g14690.1 | upstream_gene_variant ; 82.0bp to feature; MODIFIER | silent_mutation | Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| vg0508350184 | G -> A | LOC_Os05g14670-LOC_Os05g14690 | intergenic_region ; MODIFIER | silent_mutation | Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0508350184 | NA | 9.51E-06 | mr1909 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | 5.88E-06 | 1.07E-06 | mr1349_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | NA | 2.09E-06 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | 8.58E-06 | 5.11E-06 | mr1452_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | NA | 5.57E-06 | mr1576_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | NA | 4.98E-07 | mr1749_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | 4.50E-06 | 4.50E-06 | mr1821_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508350184 | NA | 6.92E-08 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |