\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508350184:

Variant ID: vg0508350184 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8350184
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:


TTCTGCGCACTAACCGTAATATACCAGGAATATTTATGCGCCATTGCTGGGATTTATATTTCTATAATGTCGTTAAGAAACACTAACAAACATTTTTGGC[G/A]
CCCTTGCTGGGAAGATTAATAAAGAGATTACTATATGCTACTAACTTTATATTTACCTCTGTATAGTCACTGTCCTTTGCAGGCTAACCTTGTTTTTTTT

Reverse complement sequence

AAAAAAAACAAGGTTAGCCTGCAAAGGACAGTGACTATACAGAGGTAAATATAAAGTTAGTAGCATATAGTAATCTCTTTATTAATCTTCCCAGCAAGGG[C/T]
GCCAAAAATGTTTGTTAGTGTTTCTTAACGACATTATAGAAATATAAATCCCAGCAATGGCGCATAAATATTCCTGGTATATTACGGTTAGTGCGCAGAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.90% 3.40% 0.63% 7.02% NA
All Indica  2759 91.50% 2.80% 0.91% 4.82% NA
All Japonica  1512 94.20% 5.60% 0.00% 0.20% NA
Aus  269 27.90% 0.00% 1.49% 70.63% NA
Indica I  595 89.60% 8.60% 1.85% 0.00% NA
Indica II  465 98.90% 0.40% 0.43% 0.22% NA
Indica III  913 90.30% 0.00% 0.11% 9.64% NA
Indica Intermediate  786 89.90% 3.10% 1.40% 5.60% NA
Temperate Japonica  767 93.10% 6.90% 0.00% 0.00% NA
Tropical Japonica  504 99.40% 0.20% 0.00% 0.40% NA
Japonica Intermediate  241 87.10% 12.40% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 0.00% 1.04% 0.00% NA
Intermediate  90 91.10% 2.20% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508350184 G -> DEL N N silent_mutation Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg0508350184 G -> A LOC_Os05g14690.1 upstream_gene_variant ; 82.0bp to feature; MODIFIER silent_mutation Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N
vg0508350184 G -> A LOC_Os05g14670-LOC_Os05g14690 intergenic_region ; MODIFIER silent_mutation Average:41.17; most accessible tissue: Zhenshan97 young leaf, score: 55.899 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508350184 NA 9.51E-06 mr1909 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 5.88E-06 1.07E-06 mr1349_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 NA 2.09E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 8.58E-06 5.11E-06 mr1452_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 NA 5.57E-06 mr1576_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 NA 4.98E-07 mr1749_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 4.50E-06 4.50E-06 mr1821_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508350184 NA 6.92E-08 mr1864_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251