\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0508006957:

Variant ID: vg0508006957 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 8006957
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TAGGTAGATTTTGATGATCACTAATAGAATTCAATAATTTTTATGATCTTTTTATGCTGTGTGAGTTTTTATTAGTTCATATGTGCTTTTGTTTATTCAG[G/T,A]
TGTGAGTTTTTGTTGAGTTAGTGTAATTATTGGCTGTAGCCTCTTTGAGTAAAGGCCAGGATTATATTCCATTATCTTAAAAAAAAATCAACAGTGTGTA

Reverse complement sequence

TACACACTGTTGATTTTTTTTTAAGATAATGGAATATAATCCTGGCCTTTACTCAAAGAGGCTACAGCCAATAATTACACTAACTCAACAAAAACTCACA[C/A,T]
CTGAATAAACAAAAGCACATATGAACTAATAAAAACTCACACAGCATAAAAAGATCATAAAAATTATTGAATTCTATTAGTGATCATCAAAATCTACCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.80% 13.20% 2.67% 2.37% NA
All Indica  2759 77.00% 14.70% 4.46% 3.84% NA
All Japonica  1512 99.10% 0.80% 0.00% 0.13% NA
Aus  269 27.10% 72.10% 0.74% 0.00% NA
Indica I  595 88.40% 0.50% 9.92% 1.18% NA
Indica II  465 63.20% 26.70% 4.73% 5.38% NA
Indica III  913 72.20% 22.20% 1.64% 3.94% NA
Indica Intermediate  786 82.10% 9.70% 3.44% 4.83% NA
Temperate Japonica  767 99.60% 0.10% 0.00% 0.26% NA
Tropical Japonica  504 98.00% 2.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 83.30% 11.10% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0508006957 G -> T LOC_Os05g14240.1 downstream_gene_variant ; 3963.0bp to feature; MODIFIER N Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> T LOC_Os05g14250.1 downstream_gene_variant ; 2524.0bp to feature; MODIFIER N Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> T LOC_Os05g14240.2 downstream_gene_variant ; 3963.0bp to feature; MODIFIER N Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> T LOC_Os05g14260.1 intron_variant ; MODIFIER N Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> DEL N N silent_mutation Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> A LOC_Os05g14240.1 downstream_gene_variant ; 3963.0bp to feature; MODIFIER silent_mutation Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> A LOC_Os05g14250.1 downstream_gene_variant ; 2524.0bp to feature; MODIFIER silent_mutation Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> A LOC_Os05g14240.2 downstream_gene_variant ; 3963.0bp to feature; MODIFIER silent_mutation Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N
vg0508006957 G -> A LOC_Os05g14260.1 intron_variant ; MODIFIER silent_mutation Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0508006957 1.34E-10 NA mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 9.52E-10 2.79E-21 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 7.29E-06 NA mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 1.23E-06 9.72E-11 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 5.94E-14 NA mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 1.47E-12 2.51E-23 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 NA 6.94E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 7.37E-13 NA mr1632_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0508006957 9.76E-12 1.78E-19 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251