\
| Variant ID: vg0508006957 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 8006957 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
TAGGTAGATTTTGATGATCACTAATAGAATTCAATAATTTTTATGATCTTTTTATGCTGTGTGAGTTTTTATTAGTTCATATGTGCTTTTGTTTATTCAG[G/T,A]
TGTGAGTTTTTGTTGAGTTAGTGTAATTATTGGCTGTAGCCTCTTTGAGTAAAGGCCAGGATTATATTCCATTATCTTAAAAAAAAATCAACAGTGTGTA
TACACACTGTTGATTTTTTTTTAAGATAATGGAATATAATCCTGGCCTTTACTCAAAGAGGCTACAGCCAATAATTACACTAACTCAACAAAAACTCACA[C/A,T]
CTGAATAAACAAAAGCACATATGAACTAATAAAAACTCACACAGCATAAAAAGATCATAAAAATTATTGAATTCTATTAGTGATCATCAAAATCTACCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.80% | 13.20% | 2.67% | 2.37% | NA |
| All Indica | 2759 | 77.00% | 14.70% | 4.46% | 3.84% | NA |
| All Japonica | 1512 | 99.10% | 0.80% | 0.00% | 0.13% | NA |
| Aus | 269 | 27.10% | 72.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 88.40% | 0.50% | 9.92% | 1.18% | NA |
| Indica II | 465 | 63.20% | 26.70% | 4.73% | 5.38% | NA |
| Indica III | 913 | 72.20% | 22.20% | 1.64% | 3.94% | NA |
| Indica Intermediate | 786 | 82.10% | 9.70% | 3.44% | 4.83% | NA |
| Temperate Japonica | 767 | 99.60% | 0.10% | 0.00% | 0.26% | NA |
| Tropical Japonica | 504 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 83.30% | 11.10% | 1.11% | 4.44% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0508006957 | G -> T | LOC_Os05g14240.1 | downstream_gene_variant ; 3963.0bp to feature; MODIFIER | N | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> T | LOC_Os05g14250.1 | downstream_gene_variant ; 2524.0bp to feature; MODIFIER | N | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> T | LOC_Os05g14240.2 | downstream_gene_variant ; 3963.0bp to feature; MODIFIER | N | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> T | LOC_Os05g14260.1 | intron_variant ; MODIFIER | N | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> DEL | N | N | silent_mutation | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> A | LOC_Os05g14240.1 | downstream_gene_variant ; 3963.0bp to feature; MODIFIER | silent_mutation | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> A | LOC_Os05g14250.1 | downstream_gene_variant ; 2524.0bp to feature; MODIFIER | silent_mutation | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> A | LOC_Os05g14240.2 | downstream_gene_variant ; 3963.0bp to feature; MODIFIER | silent_mutation | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| vg0508006957 | G -> A | LOC_Os05g14260.1 | intron_variant ; MODIFIER | silent_mutation | Average:70.941; most accessible tissue: Zhenshan97 panicle, score: 84.374 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0508006957 | 1.34E-10 | NA | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 9.52E-10 | 2.79E-21 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 7.29E-06 | NA | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 1.23E-06 | 9.72E-11 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 5.94E-14 | NA | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 1.47E-12 | 2.51E-23 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | NA | 6.94E-06 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 7.37E-13 | NA | mr1632_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0508006957 | 9.76E-12 | 1.78E-19 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |