\
| Variant ID: vg0507977136 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7977136 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.68, T: 0.31, others allele: 0.00, population size: 218. )
CACAACTGCTAGCCAAGGCGGCTGTTGGGGCGGAGAAGGCCAGGGTGAAGAAGCTGGTGGCACCGGTCGCCAGTAAGCTCTACTAGAAAAACCATTTTTC[T/C]
TGATAATGGCATTTTTTTTCAGGCAGGTAGGCCTCTCGGAGCTAAATGACTGCTTGCTAAAGTGACAACCGCGGGGTGAGATGGTTGTCCGCATGCAAAA
TTTTGCATGCGGACAACCATCTCACCCCGCGGTTGTCACTTTAGCAAGCAGTCATTTAGCTCCGAGAGGCCTACCTGCCTGAAAAAAAATGCCATTATCA[A/G]
GAAAAATGGTTTTTCTAGTAGAGCTTACTGGCGACCGGTGCCACCAGCTTCTTCACCCTGGCCTTCTCCGCCCCAACAGCCGCCTTGGCTAGCAGTTGTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.00% | 43.80% | 0.21% | 0.00% | NA |
| All Indica | 2759 | 83.40% | 16.30% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.00% | 3.50% | 0.50% | 0.00% | NA |
| Indica II | 465 | 68.20% | 31.80% | 0.00% | 0.00% | NA |
| Indica III | 913 | 79.00% | 20.80% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 88.20% | 11.50% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.80% | 97.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 53.30% | 44.40% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507977136 | T -> C | LOC_Os05g14220.1 | upstream_gene_variant ; 1378.0bp to feature; MODIFIER | silent_mutation | Average:64.13; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0507977136 | T -> C | LOC_Os05g14230.1 | upstream_gene_variant ; 3804.0bp to feature; MODIFIER | silent_mutation | Average:64.13; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| vg0507977136 | T -> C | LOC_Os05g14220-LOC_Os05g14230 | intergenic_region ; MODIFIER | silent_mutation | Average:64.13; most accessible tissue: Minghui63 root, score: 77.29 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507977136 | 3.87E-07 | NA | mr1039 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | 3.47E-06 | 4.45E-12 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 2.25E-18 | mr1133 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 3.57E-10 | mr1307 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 3.10E-10 | mr1399 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 3.45E-07 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 3.76E-13 | mr1667 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 5.82E-06 | mr1681 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 1.64E-11 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 6.83E-21 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 4.67E-09 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507977136 | NA | 5.26E-07 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |