Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507948596:

Variant ID: vg0507948596 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7948596
Reference Allele: C	Alternative Allele: T
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:

CGATGTGACCTGAAGACTGAAGTTAATAGATTCTAACGGTGGAGCTAGCGTTTTTAATACTCCCAACAAAAGTTACACATATTTCACATTTAAGTTTTTT[C/T]
AAATAAATTAATTGTTCTTATTTGTAATCTTTATGCATTCAAGACTTAAATGAAGAGATAAATTAATTTTTTTATTAGAACCCAAGGAGTCATCTAAATA

Reverse complement sequence

TATTTAGATGACTCCTTGGGTTCTAATAAAAAAATTAATTTATCTCTTCATTTAAGTCTTGAATGCATAAAGATTACAAATAAGAACAATTAATTTATTT[G/A]
AAAAAACTTAAATGTGAAATATGTGTAACTTTTGTTGGGAGTATTAAAAACGCTAGCTCCACCGTTAGAATCTATTAACTTCAGTCTTCAGGTCACATCG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.60%	44.00%	0.25%	0.13%	NA
All Indica	2759	82.60%	16.80%	0.36%	0.22%	NA
All Japonica	1512	15.70%	84.20%	0.07%	0.00%	NA
Aus	269	25.30%	74.70%	0.00%	0.00%	NA
Indica I	595	92.40%	6.60%	0.50%	0.50%	NA
Indica II	465	94.40%	5.20%	0.22%	0.22%	NA
Indica III	913	79.70%	19.80%	0.33%	0.11%	NA
Indica Intermediate	786	71.60%	27.90%	0.38%	0.13%	NA
Temperate Japonica	767	29.70%	70.30%	0.00%	0.00%	NA
Tropical Japonica	504	0.40%	99.60%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	96.30%	0.41%	0.00%	NA
VI/Aromatic	96	0.00%	100.00%	0.00%	0.00%	NA
Intermediate	90	45.60%	53.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507948596	C -> T	LOC_Os05g14180.1	upstream_gene_variant ; 2276.0bp to feature; MODIFIER	silent_mutation	Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0507948596	C -> T	LOC_Os05g14180.2	upstream_gene_variant ; 2276.0bp to feature; MODIFIER	silent_mutation	Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0507948596	C -> T	LOC_Os05g14170-LOC_Os05g14180	intergenic_region ; MODIFIER	silent_mutation	Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N
vg0507948596	C -> DEL	N	N	silent_mutation	Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507948596	NA	1.75E-06	mr1182	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	4.54E-10	mr1299	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	7.53E-06	mr1371	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	5.64E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	2.05E-15	mr1657	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	3.65E-06	mr1727	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	8.82E-07	mr1756	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	1.32E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	1.56E-06	mr1182_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	5.78E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596	NA	5.93E-17	mr1870_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251