\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507948596:

Variant ID: vg0507948596 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7948596
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CGATGTGACCTGAAGACTGAAGTTAATAGATTCTAACGGTGGAGCTAGCGTTTTTAATACTCCCAACAAAAGTTACACATATTTCACATTTAAGTTTTTT[C/T]
AAATAAATTAATTGTTCTTATTTGTAATCTTTATGCATTCAAGACTTAAATGAAGAGATAAATTAATTTTTTTATTAGAACCCAAGGAGTCATCTAAATA

Reverse complement sequence

TATTTAGATGACTCCTTGGGTTCTAATAAAAAAATTAATTTATCTCTTCATTTAAGTCTTGAATGCATAAAGATTACAAATAAGAACAATTAATTTATTT[G/A]
AAAAAACTTAAATGTGAAATATGTGTAACTTTTGTTGGGAGTATTAAAAACGCTAGCTCCACCGTTAGAATCTATTAACTTCAGTCTTCAGGTCACATCG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.60% 44.00% 0.25% 0.13% NA
All Indica  2759 82.60% 16.80% 0.36% 0.22% NA
All Japonica  1512 15.70% 84.20% 0.07% 0.00% NA
Aus  269 25.30% 74.70% 0.00% 0.00% NA
Indica I  595 92.40% 6.60% 0.50% 0.50% NA
Indica II  465 94.40% 5.20% 0.22% 0.22% NA
Indica III  913 79.70% 19.80% 0.33% 0.11% NA
Indica Intermediate  786 71.60% 27.90% 0.38% 0.13% NA
Temperate Japonica  767 29.70% 70.30% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 96.30% 0.41% 0.00% NA
VI/Aromatic  96 0.00% 100.00% 0.00% 0.00% NA
Intermediate  90 45.60% 53.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507948596 C -> T LOC_Os05g14180.1 upstream_gene_variant ; 2276.0bp to feature; MODIFIER silent_mutation Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0507948596 C -> T LOC_Os05g14180.2 upstream_gene_variant ; 2276.0bp to feature; MODIFIER silent_mutation Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0507948596 C -> T LOC_Os05g14170-LOC_Os05g14180 intergenic_region ; MODIFIER silent_mutation Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N
vg0507948596 C -> DEL N N silent_mutation Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507948596 NA 1.75E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 4.54E-10 mr1299 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 7.53E-06 mr1371 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 5.64E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 2.05E-15 mr1657 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 3.65E-06 mr1727 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 8.82E-07 mr1756 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 1.32E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 1.56E-06 mr1182_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 5.78E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507948596 NA 5.93E-17 mr1870_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251