\
| Variant ID: vg0507948596 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7948596 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.05, others allele: 0.00, population size: 107. )
CGATGTGACCTGAAGACTGAAGTTAATAGATTCTAACGGTGGAGCTAGCGTTTTTAATACTCCCAACAAAAGTTACACATATTTCACATTTAAGTTTTTT[C/T]
AAATAAATTAATTGTTCTTATTTGTAATCTTTATGCATTCAAGACTTAAATGAAGAGATAAATTAATTTTTTTATTAGAACCCAAGGAGTCATCTAAATA
TATTTAGATGACTCCTTGGGTTCTAATAAAAAAATTAATTTATCTCTTCATTTAAGTCTTGAATGCATAAAGATTACAAATAAGAACAATTAATTTATTT[G/A]
AAAAAACTTAAATGTGAAATATGTGTAACTTTTGTTGGGAGTATTAAAAACGCTAGCTCCACCGTTAGAATCTATTAACTTCAGTCTTCAGGTCACATCG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.60% | 44.00% | 0.25% | 0.13% | NA |
| All Indica | 2759 | 82.60% | 16.80% | 0.36% | 0.22% | NA |
| All Japonica | 1512 | 15.70% | 84.20% | 0.07% | 0.00% | NA |
| Aus | 269 | 25.30% | 74.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 92.40% | 6.60% | 0.50% | 0.50% | NA |
| Indica II | 465 | 94.40% | 5.20% | 0.22% | 0.22% | NA |
| Indica III | 913 | 79.70% | 19.80% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 71.60% | 27.90% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 29.70% | 70.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 3.30% | 96.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 53.30% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507948596 | C -> T | LOC_Os05g14180.1 | upstream_gene_variant ; 2276.0bp to feature; MODIFIER | silent_mutation | Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 | N | N | N | N |
| vg0507948596 | C -> T | LOC_Os05g14180.2 | upstream_gene_variant ; 2276.0bp to feature; MODIFIER | silent_mutation | Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 | N | N | N | N |
| vg0507948596 | C -> T | LOC_Os05g14170-LOC_Os05g14180 | intergenic_region ; MODIFIER | silent_mutation | Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 | N | N | N | N |
| vg0507948596 | C -> DEL | N | N | silent_mutation | Average:47.354; most accessible tissue: Zhenshan97 flower, score: 82.111 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507948596 | NA | 1.75E-06 | mr1182 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 4.54E-10 | mr1299 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 7.53E-06 | mr1371 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 5.64E-07 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 2.05E-15 | mr1657 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 3.65E-06 | mr1727 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 8.82E-07 | mr1756 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 1.32E-08 | mr1137_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 1.56E-06 | mr1182_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 5.78E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507948596 | NA | 5.93E-17 | mr1870_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |