\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507940286:

Variant ID: vg0507940286 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7940286
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, T: 0.00, others allele: 0.00, population size: 200. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGTGGCAAGAGAGTTAATGAGGAGAGAGGTAAAAATATGAAGAAACCATTCTCATGCAAGAAACCATCTCTACACAAGTAACAAGAATGAAAACAA[T/G]
GGGATATGTGGATAAAAGGAGAGAGAAGAAAGATGATTGGCTAATAATTGAATTTGAAGACAACATCCATCGGATATACTAGATGAATACCCCGCCACGT

Reverse complement sequence

ACGTGGCGGGGTATTCATCTAGTATATCCGATGGATGTTGTCTTCAAATTCAATTATTAGCCAATCATCTTTCTTCTCTCTCCTTTTATCCACATATCCC[A/C]
TTGTTTTCATTCTTGTTACTTGTGTAGAGATGGTTTCTTGCATGAGAATGGTTTCTTCATATTTTTACCTCTCTCCTCATTAACTCTCTTGCCACATAGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.50% 31.60% 0.15% 1.74% NA
All Indica  2759 94.60% 4.60% 0.14% 0.65% NA
All Japonica  1512 18.50% 81.40% 0.07% 0.00% NA
Aus  269 74.70% 1.90% 0.74% 22.68% NA
Indica I  595 97.10% 2.00% 0.17% 0.67% NA
Indica II  465 95.50% 4.10% 0.22% 0.22% NA
Indica III  913 94.00% 5.10% 0.00% 0.88% NA
Indica Intermediate  786 92.70% 6.40% 0.25% 0.64% NA
Temperate Japonica  767 32.60% 67.40% 0.00% 0.00% NA
Tropical Japonica  504 3.20% 96.80% 0.00% 0.00% NA
Japonica Intermediate  241 5.80% 93.80% 0.41% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 58.90% 37.80% 0.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507940286 T -> DEL N N silent_mutation Average:38.095; most accessible tissue: Callus, score: 53.748 N N N N
vg0507940286 T -> G LOC_Os05g14170.1 downstream_gene_variant ; 3873.0bp to feature; MODIFIER silent_mutation Average:38.095; most accessible tissue: Callus, score: 53.748 N N N N
vg0507940286 T -> G LOC_Os05g14170-LOC_Os05g14180 intergenic_region ; MODIFIER silent_mutation Average:38.095; most accessible tissue: Callus, score: 53.748 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507940286 NA 2.10E-06 mr1182 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507940286 2.16E-06 6.47E-14 mr1657 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507940286 NA 1.26E-12 mr1521_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507940286 NA 6.34E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251