\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507926447:

Variant ID: vg0507926447 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7926447
Reference Allele: TAlternative Allele: G
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, G: 0.21, others allele: 0.00, population size: 94. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGCTTTTTTTTTCTGACTTTTCTTTTTTTCTTTTTCCCTGTTTTTAAGGGCAATAGGATCTAAGGTTTTTCTTTCTTTTTTTGGAATCAGACTCTTTT[T/G]
TTTTCTAGGTTCTAGATTGTTTTTTCGCTGTTTTTTTTTTATTTTGACGGGTAGTAGAGGCCGCGCTTTTTTTCCTGACTTTTCGTTTTTTGGTTTTCTT

Reverse complement sequence

AAGAAAACCAAAAAACGAAAAGTCAGGAAAAAAAGCGCGGCCTCTACTACCCGTCAAAATAAAAAAAAAACAGCGAAAAAACAATCTAGAACCTAGAAAA[A/C]
AAAAGAGTCTGATTCCAAAAAAAGAAAGAAAAACCTTAGATCCTATTGCCCTTAAAAACAGGGAAAAAGAAAAAAAGAAAAGTCAGAAAAAAAAAGCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.20% 41.10% 5.21% 0.49% NA
All Indica  2759 81.90% 9.00% 8.45% 0.72% NA
All Japonica  1512 1.50% 98.10% 0.13% 0.20% NA
Aus  269 70.60% 27.10% 2.23% 0.00% NA
Indica I  595 88.60% 2.40% 8.57% 0.50% NA
Indica II  465 84.90% 6.00% 7.53% 1.51% NA
Indica III  913 78.50% 13.40% 7.89% 0.22% NA
Indica Intermediate  786 78.90% 10.60% 9.54% 1.02% NA
Temperate Japonica  767 1.30% 98.00% 0.26% 0.39% NA
Tropical Japonica  504 2.20% 97.80% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 99.20% 0.00% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 45.60% 48.90% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507926447 T -> DEL N N silent_mutation Average:43.862; most accessible tissue: Callus, score: 65.359 N N N N
vg0507926447 T -> G LOC_Os05g14170.1 upstream_gene_variant ; 587.0bp to feature; MODIFIER silent_mutation Average:43.862; most accessible tissue: Callus, score: 65.359 N N N N
vg0507926447 T -> G LOC_Os05g14160-LOC_Os05g14170 intergenic_region ; MODIFIER silent_mutation Average:43.862; most accessible tissue: Callus, score: 65.359 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507926447 9.25E-06 2.03E-07 mr1071 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 7.06E-06 3.98E-07 mr1080 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 NA 1.90E-06 mr1140 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 NA 1.06E-06 mr1203 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 3.33E-06 5.37E-07 mr1395 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 3.50E-07 2.53E-10 mr1071_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 1.45E-07 2.53E-10 mr1080_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 NA 6.27E-08 mr1100_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 1.37E-07 3.11E-10 mr1203_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 NA 3.36E-14 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 7.97E-07 1.98E-09 mr1613_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507926447 1.20E-06 5.36E-08 mr1619_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251