\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507898758:

Variant ID: vg0507898758 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7898758
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CTGTCAACACCTAACCATGCCTTTGCAAAACTGATATCGCAGATCACCCAAATTAAGAATAATTTTTCTGATCATCGTGTTGTTGACAGAAAACACGAGG[C/T]
CTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAGCTCGCCTTCGGGTGTGCTAGCGTGCCAGTTGATTTGATCCTATAACCAACAAGAAGTAGAAGCA

Reverse complement sequence

TGCTTCTACTTCTTGTTGGTTATAGGATCAAATCAACTGGCACGCTAGCACACCCGAAGGCGAGCTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAG[G/A]
CCTCGTGTTTTCTGTCAACAACACGATGATCAGAAAAATTATTCTTAATTTGGGTGATCTGCGATATCAGTTTTGCAAAGGCATGGTTAGGTGTTGACAG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.50% 48.20% 0.23% 0.00% NA
All Indica  2759 21.00% 78.80% 0.22% 0.00% NA
All Japonica  1512 98.90% 1.10% 0.00% 0.00% NA
Aus  269 77.70% 22.30% 0.00% 0.00% NA
Indica I  595 3.40% 96.50% 0.17% 0.00% NA
Indica II  465 27.70% 72.00% 0.22% 0.00% NA
Indica III  913 28.10% 71.60% 0.22% 0.00% NA
Indica Intermediate  786 22.10% 77.60% 0.25% 0.00% NA
Temperate Japonica  767 98.20% 1.80% 0.00% 0.00% NA
Tropical Japonica  504 99.60% 0.40% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 61.10% 33.30% 5.56% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507898758 C -> T LOC_Os05g14130.1 downstream_gene_variant ; 4425.0bp to feature; MODIFIER silent_mutation Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg0507898758 C -> T LOC_Os05g14140.1 downstream_gene_variant ; 1225.0bp to feature; MODIFIER silent_mutation Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N
vg0507898758 C -> T LOC_Os05g14140-LOC_Os05g14150 intergenic_region ; MODIFIER silent_mutation Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507898758 NA 1.47E-28 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 NA 5.96E-07 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 NA 2.21E-28 mr1632 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 NA 7.92E-08 mr1632 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 NA 3.73E-11 mr1657 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 1.72E-13 4.09E-34 mr1039_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 8.76E-11 1.54E-08 mr1039_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 NA 3.86E-15 mr1514_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 8.81E-11 1.24E-34 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758 1.05E-08 5.90E-09 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251