\
| Variant ID: vg0507898758 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7898758 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 109. )
CTGTCAACACCTAACCATGCCTTTGCAAAACTGATATCGCAGATCACCCAAATTAAGAATAATTTTTCTGATCATCGTGTTGTTGACAGAAAACACGAGG[C/T]
CTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAGCTCGCCTTCGGGTGTGCTAGCGTGCCAGTTGATTTGATCCTATAACCAACAAGAAGTAGAAGCA
TGCTTCTACTTCTTGTTGGTTATAGGATCAAATCAACTGGCACGCTAGCACACCCGAAGGCGAGCTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAG[G/A]
CCTCGTGTTTTCTGTCAACAACACGATGATCAGAAAAATTATTCTTAATTTGGGTGATCTGCGATATCAGTTTTGCAAAGGCATGGTTAGGTGTTGACAG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.50% | 48.20% | 0.23% | 0.00% | NA |
| All Indica | 2759 | 21.00% | 78.80% | 0.22% | 0.00% | NA |
| All Japonica | 1512 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 77.70% | 22.30% | 0.00% | 0.00% | NA |
| Indica I | 595 | 3.40% | 96.50% | 0.17% | 0.00% | NA |
| Indica II | 465 | 27.70% | 72.00% | 0.22% | 0.00% | NA |
| Indica III | 913 | 28.10% | 71.60% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 22.10% | 77.60% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 61.10% | 33.30% | 5.56% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507898758 | C -> T | LOC_Os05g14130.1 | downstream_gene_variant ; 4425.0bp to feature; MODIFIER | silent_mutation | Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317 | N | N | N | N |
| vg0507898758 | C -> T | LOC_Os05g14140.1 | downstream_gene_variant ; 1225.0bp to feature; MODIFIER | silent_mutation | Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317 | N | N | N | N |
| vg0507898758 | C -> T | LOC_Os05g14140-LOC_Os05g14150 | intergenic_region ; MODIFIER | silent_mutation | Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507898758 | NA | 1.47E-28 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | NA | 5.96E-07 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | NA | 2.21E-28 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | NA | 7.92E-08 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | NA | 3.73E-11 | mr1657 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | 1.72E-13 | 4.09E-34 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | 8.76E-11 | 1.54E-08 | mr1039_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | NA | 3.86E-15 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | 8.81E-11 | 1.24E-34 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507898758 | 1.05E-08 | 5.90E-09 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |