Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507898758:

Variant ID: vg0507898758 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7898758
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.94, T: 0.06, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:

CTGTCAACACCTAACCATGCCTTTGCAAAACTGATATCGCAGATCACCCAAATTAAGAATAATTTTTCTGATCATCGTGTTGTTGACAGAAAACACGAGG[C/T]
CTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAGCTCGCCTTCGGGTGTGCTAGCGTGCCAGTTGATTTGATCCTATAACCAACAAGAAGTAGAAGCA

Reverse complement sequence

TGCTTCTACTTCTTGTTGGTTATAGGATCAAATCAACTGGCACGCTAGCACACCCGAAGGCGAGCTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAG[G/A]
CCTCGTGTTTTCTGTCAACAACACGATGATCAGAAAAATTATTCTTAATTTGGGTGATCTGCGATATCAGTTTTGCAAAGGCATGGTTAGGTGTTGACAG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	51.50%	48.20%	0.23%	0.00%	NA
All Indica	2759	21.00%	78.80%	0.22%	0.00%	NA
All Japonica	1512	98.90%	1.10%	0.00%	0.00%	NA
Aus	269	77.70%	22.30%	0.00%	0.00%	NA
Indica I	595	3.40%	96.50%	0.17%	0.00%	NA
Indica II	465	27.70%	72.00%	0.22%	0.00%	NA
Indica III	913	28.10%	71.60%	0.22%	0.00%	NA
Indica Intermediate	786	22.10%	77.60%	0.25%	0.00%	NA
Temperate Japonica	767	98.20%	1.80%	0.00%	0.00%	NA
Tropical Japonica	504	99.60%	0.40%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	61.10%	33.30%	5.56%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507898758	C -> T	LOC_Os05g14130.1	downstream_gene_variant ; 4425.0bp to feature; MODIFIER	silent_mutation	Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg0507898758	C -> T	LOC_Os05g14140.1	downstream_gene_variant ; 1225.0bp to feature; MODIFIER	silent_mutation	Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N
vg0507898758	C -> T	LOC_Os05g14140-LOC_Os05g14150	intergenic_region ; MODIFIER	silent_mutation	Average:61.243; most accessible tissue: Zhenshan97 flower, score: 78.317	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507898758	NA	1.47E-28	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	NA	5.96E-07	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	NA	2.21E-28	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	NA	7.92E-08	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	NA	3.73E-11	mr1657	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	1.72E-13	4.09E-34	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	8.76E-11	1.54E-08	mr1039_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	NA	3.86E-15	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	8.81E-11	1.24E-34	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507898758	1.05E-08	5.90E-09	mr1632_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251