\
| Variant ID: vg0507887823 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7887823 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.04, others allele: 0.00, population size: 218. )
TCGTCCGACGACGGCAAACACCTCCTCGTCGACATACACGAAGGGGTCTGTGGGTCAGATGCCGCCGGTCGTACATTGGTCGGAAAAGCCTTTCGACAAG[A/G]
ATTTTTCTGGCCAACCGCCCTCAAAGACACTTGCGACATGGTACAACGGTGTGAAGCTTGCCAATTTCATAGCAAACACACAAAACTACCAGCGCAAGCA
TGCTTGCGCTGGTAGTTTTGTGTGTTTGCTATGAAATTGGCAAGCTTCACACCGTTGTACCATGTCGCAAGTGTCTTTGAGGGCGGTTGGCCAGAAAAAT[T/C]
CTTGTCGAAAGGCTTTTCCGACCAATGTACGACCGGCGGCATCTGACCCACAGACCCCTTCGTGTATGTCGACGAGGAGGTGTTTGCCGTCGTCGGACGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 56.20% | 43.60% | 0.28% | 0.00% | NA |
| All Indica | 2759 | 84.20% | 15.40% | 0.40% | 0.00% | NA |
| All Japonica | 1512 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 98.10% | 1.90% | 0.00% | 0.00% | NA |
| Indica I | 595 | 96.60% | 2.50% | 0.84% | 0.00% | NA |
| Indica II | 465 | 68.60% | 31.20% | 0.22% | 0.00% | NA |
| Indica III | 913 | 83.20% | 16.40% | 0.33% | 0.00% | NA |
| Indica Intermediate | 786 | 85.00% | 14.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 1.80% | 98.20% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 98.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 99.20% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 45.60% | 52.20% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507887823 | A -> G | LOC_Os05g14110.1 | missense_variant ; p.Glu1397Gly; MODERATE | nonsynonymous_codon ; E1397G | Average:56.071; most accessible tissue: Minghui63 flag leaf, score: 77.494 | benign |
-0.569 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507887823 | 3.96E-10 | 4.63E-35 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 5.86E-09 | 5.06E-10 | mr1039 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | NA | 1.15E-11 | mr1514 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 8.44E-09 | 1.48E-38 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 1.54E-07 | 9.92E-11 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | NA | 6.05E-06 | mr1832 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | NA | 1.64E-08 | mr1986 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 1.30E-12 | 1.74E-36 | mr1039_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 4.09E-09 | 7.94E-09 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | NA | 2.88E-13 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 6.87E-12 | 1.60E-45 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507887823 | 1.49E-08 | 2.98E-10 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |