\
| Variant ID: vg0507885416 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7885416 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.03, others allele: 0.00, population size: 115. )
TCGGAAGAACGGCACTCACGAAGTTCATGGCCGCATCTTACTACGTGTATCAGGTACTCAAGATGCCCGGGCCGAATGAAACAATCACTATCCAAGGGAA[C/T]
GCAAAGCTAGCGGTCCAATGCGACAAGCGGAGCCTCGACATGGTCGAGCACACTCCCAGCCCACCCGCCACAGCCGAGCCACCCAAGAAAGTGATCAAAA
TTTTGATCACTTTCTTGGGTGGCTCGGCTGTGGCGGGTGGGCTGGGAGTGTGCTCGACCATGTCGAGGCTCCGCTTGTCGCATTGGACCGCTAGCTTTGC[G/A]
TTCCCTTGGATAGTGATTGTTTCATTCGGCCCGGGCATCTTGAGTACCTGATACACGTAGTAAGATGCGGCCATGAACTTCGTGAGTGCCGTTCTTCCGA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.70% | 47.90% | 0.32% | 0.00% | NA |
| All Indica | 2759 | 21.10% | 78.40% | 0.51% | 0.00% | NA |
| All Japonica | 1512 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Aus | 269 | 78.40% | 21.20% | 0.37% | 0.00% | NA |
| Indica I | 595 | 4.50% | 95.30% | 0.17% | 0.00% | NA |
| Indica II | 465 | 32.70% | 67.30% | 0.00% | 0.00% | NA |
| Indica III | 913 | 24.50% | 74.30% | 1.20% | 0.00% | NA |
| Indica Intermediate | 786 | 22.90% | 76.80% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 98.20% | 1.80% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 67.80% | 32.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507885416 | C -> T | LOC_Os05g14110.1 | synonymous_variant ; p.Asn794Asn; LOW | synonymous_codon | Average:31.645; most accessible tissue: Zhenshan97 flag leaf, score: 44.637 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507885416 | 7.20E-07 | 1.25E-30 | mr1039 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | NA | 1.43E-08 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | 5.08E-06 | 3.12E-28 | mr1632 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | NA | 4.34E-08 | mr1632 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | 1.23E-09 | 2.76E-33 | mr1039_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | 1.70E-07 | 2.65E-08 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | NA | 2.35E-15 | mr1514_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | 5.78E-10 | 2.62E-34 | mr1632_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507885416 | 4.13E-08 | 3.86E-09 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |