\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507827115:

Variant ID: vg0507827115 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7827115
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


CAGGGTGGGGTGACCGCTCATGGTGACGAGAAGGAGGCAGCTGGCCATGGATCTGGAGGTGGCAGCGGTTAGTCAACCTCGAGCTCGACCTGGCGCCGAC[G/T,A]
GTTGCTGATAGAGGTGGAGTGGTGTAGGTGGTGGCAGTGGTGGTGGATGATGGACACGAGAAGGGGGCGGCTAGAAATACCGTCACCAAGAGAGATGAGT

Reverse complement sequence

ACTCATCTCTCTTGGTGACGGTATTTCTAGCCGCCCCCTTCTCGTGTCCATCATCCACCACCACTGCCACCACCTACACCACTCCACCTCTATCAGCAAC[C/A,T]
GTCGGCGCCAGGTCGAGCTCGAGGTTGACTAACCGCTGCCACCTCCAGATCCATGGCCAGCTGCCTCCTTCTCGTCACCATGAGCGGTCACCCCACCCTG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.90% 2.40% 1.69% 0.00% A: 0.04%
All Indica  2759 93.00% 4.10% 2.86% 0.00% A: 0.07%
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 87.70% 4.00% 8.24% 0.00% NA
Indica II  465 97.40% 2.20% 0.43% 0.00% NA
Indica III  913 94.40% 4.80% 0.55% 0.00% A: 0.22%
Indica Intermediate  786 92.70% 4.30% 2.93% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 0.00% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507827115 G -> T LOC_Os05g14010-LOC_Os05g14030 intergenic_region ; MODIFIER silent_mutation Average:64.014; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N
vg0507827115 G -> A LOC_Os05g14010-LOC_Os05g14030 intergenic_region ; MODIFIER silent_mutation Average:64.014; most accessible tissue: Zhenshan97 young leaf, score: 86.383 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507827115 3.00E-06 3.00E-06 mr1102 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507827115 NA 4.34E-06 mr1123_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507827115 NA 1.35E-06 mr1496_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507827115 NA 1.10E-08 mr1855_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507827115 NA 3.62E-06 mr1914_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507827115 NA 1.23E-06 mr1927_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251