Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507782081:

Variant ID: vg0507782081 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 7782081
Reference Allele: TAlternative Allele: C,TCTATGTAC
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.74, T: 0.27, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


TCTATATATCCCCAATCAACAAATATAGAAAATACTTCATCCGTCCTAATATATAGTAATATAGAACGTGTCATTATGAATTTAAACATGTATCCATGTA[T/C,TCTATGTAC]
CTATATGAAGATATTGCTGAAACGAAGGTAATAGGAACGTAGGATATATGTTATAGTATTTGACATATAGGCCTGCAGCGTTGTCAAGTGGCAATGCAAT

Reverse complement sequence

ATTGCATTGCCACTTGACAACGCTGCAGGCCTATATGTCAAATACTATAACATATATCCTACGTTCCTATTACCTTCGTTTCAGCAATATCTTCATATAG[A/G,GTACATAGA]
TACATGGATACATGTTTAAATTCATAATGACACGTTCTATATTACTATATATTAGGACGGATGAAGTATTTTCTATATTTGTTGATTGGGGATATATAGA

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 44.10% 1.10% 0.83% TCTATGTAC: 0.36%
All Indica  2759 33.00% 64.20% 1.41% 0.76% TCTATGTAC: 0.58%
All Japonica  1512 98.20% 1.30% 0.40% 0.07% NA
Aus  269 4.10% 95.50% 0.00% 0.37% NA
Indica I  595 59.20% 37.00% 2.35% 0.67% TCTATGTAC: 0.84%
Indica II  465 26.70% 71.00% 0.65% 0.86% TCTATGTAC: 0.86%
Indica III  913 23.20% 75.70% 0.77% 0.22% TCTATGTAC: 0.11%
Indica Intermediate  786 28.40% 67.60% 1.91% 1.40% TCTATGTAC: 0.76%
Temperate Japonica  767 97.50% 1.70% 0.65% 0.13% NA
Tropical Japonica  504 98.80% 1.20% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 81.20% 1.00% 3.12% 14.58% NA
Intermediate  90 55.60% 36.70% 4.44% 2.22% TCTATGTAC: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507782081 T -> TCTATGTAC LOC_Os05g13970.1 upstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> TCTATGTAC LOC_Os05g13970.2 upstream_gene_variant ; 1108.0bp to feature; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> TCTATGTAC LOC_Os05g13980.1 downstream_gene_variant ; 3005.0bp to feature; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> TCTATGTAC LOC_Os05g13970-LOC_Os05g13980 intergenic_region ; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> DEL N N silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> C LOC_Os05g13970.1 upstream_gene_variant ; 1107.0bp to feature; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> C LOC_Os05g13970.2 upstream_gene_variant ; 1107.0bp to feature; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> C LOC_Os05g13980.1 downstream_gene_variant ; 3006.0bp to feature; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N
vg0507782081 T -> C LOC_Os05g13970-LOC_Os05g13980 intergenic_region ; MODIFIER silent_mutation Average:83.721; most accessible tissue: Zhenshan97 root, score: 95.697 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507782081 T C 0.0 -0.06 -0.05 -0.01 -0.03 -0.01
vg0507782081 T TCTAT* -0.17 0.27 0.23 -0.04 -0.13 -0.31

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507782081 NA 7.71E-27 mr1039 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507782081 2.62E-07 3.35E-31 mr1039_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507782081 NA 3.67E-08 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507782081 1.37E-06 1.34E-35 mr1632_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507782081 NA 4.29E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251