Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507694055:

Variant ID: vg0507694055 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7694055
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTTTAACAAATCTCAAAAAGGTTATTGCTAATAAATGCGTTTTATTCCTTTTTTTAATTAGTTCACATTTGACACAATTTGTTGTATGTACTTACATAT[C/G]
AATCAATAAAAATAGAGTAGATATATTCTAGACCTCGCATCCTATAATATGTGTGATATATATTTTTTAAATACATTTTGTCGACCCGAGTGTTAAAACT

Reverse complement sequence

AGTTTTAACACTCGGGTCGACAAAATGTATTTAAAAAATATATATCACACATATTATAGGATGCGAGGTCTAGAATATATCTACTCTATTTTTATTGATT[G/C]
ATATGTAAGTACATACAACAAATTGTGTCAAATGTGAACTAATTAAAAAAAGGAATAAAACGCATTTATTAGCAATAACCTTTTTGAGATTTGTTAAAAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.50% 5.10% 1.29% 1.12% NA
All Indica  2759 92.10% 4.30% 2.17% 1.41% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 52.80% 42.00% 0.37% 4.83% NA
Indica I  595 99.00% 0.30% 0.34% 0.34% NA
Indica II  465 94.00% 2.20% 1.94% 1.94% NA
Indica III  913 91.10% 5.30% 1.53% 2.08% NA
Indica Intermediate  786 87.00% 7.40% 4.45% 1.15% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 92.20% 6.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507694055 C -> DEL N N silent_mutation Average:19.096; most accessible tissue: Callus, score: 49.135 N N N N
vg0507694055 C -> G LOC_Os05g13840.1 upstream_gene_variant ; 3684.0bp to feature; MODIFIER silent_mutation Average:19.096; most accessible tissue: Callus, score: 49.135 N N N N
vg0507694055 C -> G LOC_Os05g13850.1 upstream_gene_variant ; 753.0bp to feature; MODIFIER silent_mutation Average:19.096; most accessible tissue: Callus, score: 49.135 N N N N
vg0507694055 C -> G LOC_Os05g13850-LOC_Os05g13860 intergenic_region ; MODIFIER silent_mutation Average:19.096; most accessible tissue: Callus, score: 49.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507694055 NA 3.26E-07 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 3.97E-06 4.65E-07 mr1030 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 4.53E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 3.43E-06 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 1.80E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 4.95E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 1.80E-06 mr1265 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 5.44E-06 9.65E-07 mr1265 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 3.30E-06 NA mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 2.25E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 3.19E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 6.02E-08 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 2.09E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 3.53E-06 3.52E-06 mr1396 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 9.49E-07 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 6.91E-06 mr1425 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 1.37E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 5.93E-08 mr1444 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 1.67E-07 mr1453 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 3.52E-06 3.51E-06 mr1481 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 3.18E-06 5.02E-11 mr1499 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 7.41E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 9.88E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 6.79E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 3.91E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 8.27E-07 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 3.21E-07 mr1652 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 8.51E-09 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 8.22E-11 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 9.79E-06 mr1730 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 1.37E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 8.47E-06 mr1956 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694055 NA 8.81E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251