Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507694035:

Variant ID: vg0507694035 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7694035
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATTGAATGTGTTGGGCTCTTATTTTAACAAATCTCAAAAAGGTTATTGCTAATAAATGCGTTTTATTCCTTTTTTTAATTAGTTCACATTTGACACAATT[T/A]
GTTGTATGTACTTACATATCAATCAATAAAAATAGAGTAGATATATTCTAGACCTCGCATCCTATAATATGTGTGATATATATTTTTTAAATACATTTTG

Reverse complement sequence

CAAAATGTATTTAAAAAATATATATCACACATATTATAGGATGCGAGGTCTAGAATATATCTACTCTATTTTTATTGATTGATATGTAAGTACATACAAC[A/T]
AATTGTGTCAAATGTGAACTAATTAAAAAAAGGAATAAAACGCATTTATTAGCAATAACCTTTTTGAGATTTGTTAAAATAAGAGCCCAACACATTCAAT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.60%	0.40%	2.52%	4.42%	NA
All Indica	2759	92.20%	0.40%	1.56%	5.84%	NA
All Japonica	1512	99.90%	0.10%	0.07%	0.00%	NA
Aus	269	53.50%	3.00%	26.77%	16.73%	NA
Indica I	595	99.00%	0.00%	0.00%	1.01%	NA
Indica II	465	94.00%	0.20%	0.65%	5.16%	NA
Indica III	913	91.20%	0.50%	1.20%	7.01%	NA
Indica Intermediate	786	87.00%	0.80%	3.69%	8.52%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.40%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	94.40%	0.00%	3.33%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507694035	T -> DEL	N	N	silent_mutation	Average:19.122; most accessible tissue: Callus, score: 49.135	N	N	N	N
vg0507694035	T -> A	LOC_Os05g13840.1	upstream_gene_variant ; 3664.0bp to feature; MODIFIER	silent_mutation	Average:19.122; most accessible tissue: Callus, score: 49.135	N	N	N	N
vg0507694035	T -> A	LOC_Os05g13850.1	upstream_gene_variant ; 733.0bp to feature; MODIFIER	silent_mutation	Average:19.122; most accessible tissue: Callus, score: 49.135	N	N	N	N
vg0507694035	T -> A	LOC_Os05g13850-LOC_Os05g13860	intergenic_region ; MODIFIER	silent_mutation	Average:19.122; most accessible tissue: Callus, score: 49.135	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507694035	NA	2.41E-06	mr1028	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	9.39E-06	1.21E-06	mr1030	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	4.72E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	1.64E-06	mr1265	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	4.01E-06	7.33E-07	mr1265	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	3.14E-06	NA	mr1316	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	4.53E-06	mr1331	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	2.80E-07	mr1369	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	9.51E-07	mr1393	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	7.09E-06	7.08E-06	mr1396	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	2.16E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	5.68E-06	mr1427	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	1.86E-07	mr1444	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	5.85E-06	1.42E-10	mr1499	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	5.79E-06	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	9.12E-06	mr1544	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	6.70E-06	mr1545	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	6.04E-07	mr1574	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	7.01E-06	mr1614	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	6.46E-06	mr1634	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	1.90E-08	mr1659	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	1.03E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	7.91E-06	mr1730	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	2.69E-06	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	6.72E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035	NA	4.96E-14	mr1846_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251