\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507694035:

Variant ID: vg0507694035 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7694035
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATTGAATGTGTTGGGCTCTTATTTTAACAAATCTCAAAAAGGTTATTGCTAATAAATGCGTTTTATTCCTTTTTTTAATTAGTTCACATTTGACACAATT[T/A]
GTTGTATGTACTTACATATCAATCAATAAAAATAGAGTAGATATATTCTAGACCTCGCATCCTATAATATGTGTGATATATATTTTTTAAATACATTTTG

Reverse complement sequence

CAAAATGTATTTAAAAAATATATATCACACATATTATAGGATGCGAGGTCTAGAATATATCTACTCTATTTTTATTGATTGATATGTAAGTACATACAAC[A/T]
AATTGTGTCAAATGTGAACTAATTAAAAAAAGGAATAAAACGCATTTATTAGCAATAACCTTTTTGAGATTTGTTAAAATAAGAGCCCAACACATTCAAT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.60% 0.40% 2.52% 4.42% NA
All Indica  2759 92.20% 0.40% 1.56% 5.84% NA
All Japonica  1512 99.90% 0.10% 0.07% 0.00% NA
Aus  269 53.50% 3.00% 26.77% 16.73% NA
Indica I  595 99.00% 0.00% 0.00% 1.01% NA
Indica II  465 94.00% 0.20% 0.65% 5.16% NA
Indica III  913 91.20% 0.50% 1.20% 7.01% NA
Indica Intermediate  786 87.00% 0.80% 3.69% 8.52% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.40% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 0.00% 0.00% 1.04% NA
Intermediate  90 94.40% 0.00% 3.33% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507694035 T -> DEL N N silent_mutation Average:19.122; most accessible tissue: Callus, score: 49.135 N N N N
vg0507694035 T -> A LOC_Os05g13840.1 upstream_gene_variant ; 3664.0bp to feature; MODIFIER silent_mutation Average:19.122; most accessible tissue: Callus, score: 49.135 N N N N
vg0507694035 T -> A LOC_Os05g13850.1 upstream_gene_variant ; 733.0bp to feature; MODIFIER silent_mutation Average:19.122; most accessible tissue: Callus, score: 49.135 N N N N
vg0507694035 T -> A LOC_Os05g13850-LOC_Os05g13860 intergenic_region ; MODIFIER silent_mutation Average:19.122; most accessible tissue: Callus, score: 49.135 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507694035 NA 2.41E-06 mr1028 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 9.39E-06 1.21E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 4.72E-06 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 1.64E-06 mr1265 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 4.01E-06 7.33E-07 mr1265 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 3.14E-06 NA mr1316 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 4.53E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 2.80E-07 mr1369 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 9.51E-07 mr1393 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 7.09E-06 7.08E-06 mr1396 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 2.16E-06 mr1397 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 5.68E-06 mr1427 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 1.86E-07 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 5.85E-06 1.42E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 5.79E-06 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 9.12E-06 mr1544 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 6.70E-06 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 6.04E-07 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 7.01E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 6.46E-06 mr1634 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 1.90E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 1.03E-09 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 7.91E-06 mr1730 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 2.69E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 6.72E-06 mr1968 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507694035 NA 4.96E-14 mr1846_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251