Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507693857:

Variant ID: vg0507693857 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7693857
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTGGGCATTCATGAATCATTGCTTAAATATTTCTTTTAAGATATTTGTTAGTTTATAATATGAAATATTTAATTAATCTATATAAGCACCTATCTATAAA[G/A]
TTAATCTTCTTCATCATTTAAGAAGACATAGGTCTTTTAAGTCTAAATTAAAAAGTAAGGTGTTGTTTTTCTTTTTAATTGAATGTGTTGGGCTCTTATT

Reverse complement sequence

AATAAGAGCCCAACACATTCAATTAAAAAGAAAAACAACACCTTACTTTTTAATTTAGACTTAAAAGACCTATGTCTTCTTAAATGATGAAGAAGATTAA[C/T]
TTTATAGATAGGTGCTTATATAGATTAATTAAATATTTCATATTATAAACTAACAAATATCTTAAAAGAAATATTTAAGCAATGATTCATGAATGCCCAC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	92.90%	3.80%	0.19%	3.05%	NA
All Indica	2759	92.20%	6.50%	0.25%	1.05%	NA
All Japonica	1512	99.90%	0.00%	0.00%	0.07%	NA
Aus	269	58.70%	0.00%	0.37%	40.89%	NA
Indica I	595	99.00%	1.00%	0.00%	0.00%	NA
Indica II	465	94.20%	5.60%	0.22%	0.00%	NA
Indica III	913	91.80%	7.40%	0.11%	0.66%	NA
Indica Intermediate	786	86.40%	10.10%	0.64%	2.93%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.00%	0.00%	0.41%	NA
VI/Aromatic	96	99.00%	0.00%	0.00%	1.04%	NA
Intermediate	90	93.30%	2.20%	1.11%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507693857	G -> DEL	N	N	silent_mutation	Average:17.263; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0507693857	G -> A	LOC_Os05g13840.1	upstream_gene_variant ; 3486.0bp to feature; MODIFIER	silent_mutation	Average:17.263; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0507693857	G -> A	LOC_Os05g13850.1	upstream_gene_variant ; 555.0bp to feature; MODIFIER	silent_mutation	Average:17.263; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N
vg0507693857	G -> A	LOC_Os05g13850-LOC_Os05g13860	intergenic_region ; MODIFIER	silent_mutation	Average:17.263; most accessible tissue: Zhenshan97 panicle, score: 36.038	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507693857	7.41E-06	NA	mr1030	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	NA	4.37E-06	mr1229	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	NA	8.16E-06	mr1265	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	1.18E-06	2.26E-07	mr1265	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	NA	2.72E-06	mr1425	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	NA	3.03E-06	mr1528	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	NA	3.80E-06	mr1730	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507693857	NA	3.28E-06	mr1968	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251