Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507628936:

Variant ID: vg0507628936 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7628936
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.90, A: 0.10, others allele: 0.00, population size: 103. )

Flanking Sequence (100 bp) in Reference Genome:

AAAAAAATAGTGACAGCAAGGATTGCGTTAGGACAATTAAAAATCTTCAGATAAGATTTACTTGAAACGAGGAAAATACCTTAATTTCTATAGAATGGAA[G/A]
GAATAGAAGTGAAATTTCCATGTGAACCGAGAAGTTTATAACTACTTTCCTATTAATTCAGAGTATTTTTGTTTTTTTTTCTCCTCACATTATACTTTTT

Reverse complement sequence

AAAAAGTATAATGTGAGGAGAAAAAAAAACAAAAATACTCTGAATTAATAGGAAAGTAGTTATAAACTTCTCGGTTCACATGGAAATTTCACTTCTATTC[C/T]
TTCCATTCTATAGAAATTAAGGTATTTTCCTCGTTTCAAGTAAATCTTATCTGAAGATTTTTAATTGTCCTAACGCAATCCTTGCTGTCACTATTTTTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.70%	44.00%	0.25%	0.04%	NA
All Indica	2759	82.30%	17.20%	0.40%	0.07%	NA
All Japonica	1512	8.10%	91.90%	0.00%	0.00%	NA
Aus	269	74.30%	25.70%	0.00%	0.00%	NA
Indica I	595	95.00%	4.50%	0.50%	0.00%	NA
Indica II	465	74.40%	24.90%	0.43%	0.22%	NA
Indica III	913	78.90%	20.80%	0.22%	0.11%	NA
Indica Intermediate	786	81.60%	17.90%	0.51%	0.00%	NA
Temperate Japonica	767	2.00%	98.00%	0.00%	0.00%	NA
Tropical Japonica	504	19.60%	80.40%	0.00%	0.00%	NA
Japonica Intermediate	241	3.70%	96.30%	0.00%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	38.90%	60.00%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507628936	G -> DEL	N	N	silent_mutation	Average:42.968; most accessible tissue: Callus, score: 55.348	N	N	N	N
vg0507628936	G -> A	LOC_Os05g13760.1	upstream_gene_variant ; 2115.0bp to feature; MODIFIER	silent_mutation	Average:42.968; most accessible tissue: Callus, score: 55.348	N	N	N	N
vg0507628936	G -> A	LOC_Os05g13770.1	upstream_gene_variant ; 1242.0bp to feature; MODIFIER	silent_mutation	Average:42.968; most accessible tissue: Callus, score: 55.348	N	N	N	N
vg0507628936	G -> A	LOC_Os05g13760-LOC_Os05g13770	intergenic_region ; MODIFIER	silent_mutation	Average:42.968; most accessible tissue: Callus, score: 55.348	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507628936	NA	4.73E-26	mr1039	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	1.02E-27	mr1632	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	2.96E-06	mr1632	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	3.07E-06	mr1832	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	1.98E-10	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	1.74E-06	2.55E-30	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	2.42E-06	NA	mr1039_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	3.38E-13	mr1514_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	2.09E-07	1.35E-37	mr1632_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	2.69E-07	2.65E-08	mr1632_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	5.76E-11	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507628936	NA	2.44E-14	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251