\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507595464:

Variant ID: vg0507595464 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7595464
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 222. )

Flanking Sequence (100 bp) in Reference Genome:


ACAAAAACTACGGAGATTTGCACCAGATTAAAAACAAGACATATGAGAAGAGCTCGACAAACTTCTCAAAGCTAGTTTCATCAGAGAGGTACTCCATCCA[G/A]
AGTGGCTAGCCAATCCAGTCATGGTGCGGAAGGCCAACGGGAAATGGAGAATGTGCGTCGATTTCACCGACCTCAACAAGGCGTGTCCCAAGGATCACTT

Reverse complement sequence

AAGTGATCCTTGGGACACGCCTTGTTGAGGTCGGTGAAATCGACGCACATTCTCCATTTCCCGTTGGCCTTCCGCACCATGACTGGATTGGCTAGCCACT[C/T]
TGGATGGAGTACCTCTCTGATGAAACTAGCTTTGAGAAGTTTGTCGAGCTCTTCTCATATGTCTTGTTTTTAATCTGGTGCAAATCTCCGTAGTTTTTGT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.30% 4.80% 13.61% 9.31% NA
All Indica  2759 60.60% 1.90% 22.36% 15.11% NA
All Japonica  1512 99.10% 0.10% 0.26% 0.60% NA
Aus  269 30.90% 61.30% 5.58% 2.23% NA
Indica I  595 46.90% 0.00% 34.29% 18.82% NA
Indica II  465 62.60% 1.10% 19.78% 16.56% NA
Indica III  913 69.20% 2.30% 15.01% 13.47% NA
Indica Intermediate  786 59.90% 3.30% 23.41% 13.36% NA
Temperate Japonica  767 98.70% 0.00% 0.39% 0.91% NA
Tropical Japonica  504 99.40% 0.00% 0.20% 0.40% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 76.70% 6.70% 7.78% 8.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507595464 G -> DEL N N silent_mutation Average:7.495; most accessible tissue: Callus, score: 19.481 N N N N
vg0507595464 G -> A LOC_Os05g13710.1 upstream_gene_variant ; 21.0bp to feature; MODIFIER silent_mutation Average:7.495; most accessible tissue: Callus, score: 19.481 N N N N
vg0507595464 G -> A LOC_Os05g13720.1 upstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:7.495; most accessible tissue: Callus, score: 19.481 N N N N
vg0507595464 G -> A LOC_Os05g13700.1 downstream_gene_variant ; 232.0bp to feature; MODIFIER silent_mutation Average:7.495; most accessible tissue: Callus, score: 19.481 N N N N
vg0507595464 G -> A LOC_Os05g13700-LOC_Os05g13710 intergenic_region ; MODIFIER silent_mutation Average:7.495; most accessible tissue: Callus, score: 19.481 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507595464 7.63E-06 NA mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464 3.12E-07 NA mr1107 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464 5.54E-06 NA mr1139 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464 NA 3.30E-16 mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507595464 NA 2.02E-06 mr1278 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251