\
| Variant ID: vg0507595464 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7595464 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.01, others allele: 0.00, population size: 222. )
ACAAAAACTACGGAGATTTGCACCAGATTAAAAACAAGACATATGAGAAGAGCTCGACAAACTTCTCAAAGCTAGTTTCATCAGAGAGGTACTCCATCCA[G/A]
AGTGGCTAGCCAATCCAGTCATGGTGCGGAAGGCCAACGGGAAATGGAGAATGTGCGTCGATTTCACCGACCTCAACAAGGCGTGTCCCAAGGATCACTT
AAGTGATCCTTGGGACACGCCTTGTTGAGGTCGGTGAAATCGACGCACATTCTCCATTTCCCGTTGGCCTTCCGCACCATGACTGGATTGGCTAGCCACT[C/T]
TGGATGGAGTACCTCTCTGATGAAACTAGCTTTGAGAAGTTTGTCGAGCTCTTCTCATATGTCTTGTTTTTAATCTGGTGCAAATCTCCGTAGTTTTTGT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.30% | 4.80% | 13.61% | 9.31% | NA |
| All Indica | 2759 | 60.60% | 1.90% | 22.36% | 15.11% | NA |
| All Japonica | 1512 | 99.10% | 0.10% | 0.26% | 0.60% | NA |
| Aus | 269 | 30.90% | 61.30% | 5.58% | 2.23% | NA |
| Indica I | 595 | 46.90% | 0.00% | 34.29% | 18.82% | NA |
| Indica II | 465 | 62.60% | 1.10% | 19.78% | 16.56% | NA |
| Indica III | 913 | 69.20% | 2.30% | 15.01% | 13.47% | NA |
| Indica Intermediate | 786 | 59.90% | 3.30% | 23.41% | 13.36% | NA |
| Temperate Japonica | 767 | 98.70% | 0.00% | 0.39% | 0.91% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 76.70% | 6.70% | 7.78% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507595464 | G -> DEL | N | N | silent_mutation | Average:7.495; most accessible tissue: Callus, score: 19.481 | N | N | N | N |
| vg0507595464 | G -> A | LOC_Os05g13710.1 | upstream_gene_variant ; 21.0bp to feature; MODIFIER | silent_mutation | Average:7.495; most accessible tissue: Callus, score: 19.481 | N | N | N | N |
| vg0507595464 | G -> A | LOC_Os05g13720.1 | upstream_gene_variant ; 3972.0bp to feature; MODIFIER | silent_mutation | Average:7.495; most accessible tissue: Callus, score: 19.481 | N | N | N | N |
| vg0507595464 | G -> A | LOC_Os05g13700.1 | downstream_gene_variant ; 232.0bp to feature; MODIFIER | silent_mutation | Average:7.495; most accessible tissue: Callus, score: 19.481 | N | N | N | N |
| vg0507595464 | G -> A | LOC_Os05g13700-LOC_Os05g13710 | intergenic_region ; MODIFIER | silent_mutation | Average:7.495; most accessible tissue: Callus, score: 19.481 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507595464 | 7.63E-06 | NA | mr1103 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507595464 | 3.12E-07 | NA | mr1107 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507595464 | 5.54E-06 | NA | mr1139 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507595464 | NA | 3.30E-16 | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507595464 | NA | 2.02E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |