\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507588250:

Variant ID: vg0507588250 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7588250
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:


ATTCTTGTATCCCCTTGCACGTTTGCATCATTGGTGTGGCTTGCTGAGTACGGTGGTTGTAGTCAGCCTTGCTATTATTCCCCCTTTTCAGAAGTGTAGT[A/G]
CTTCTGAGCTGAAGACAAAGTTAGAAGACCAAGGCTTAGAACCCAGTTGAGTTTTGCCTATGGAGTGGAGCTGAAGCCCCGCTAGGATCGCCTTTTTCCG

Reverse complement sequence

CGGAAAAAGGCGATCCTAGCGGGGCTTCAGCTCCACTCCATAGGCAAAACTCAACTGGGTTCTAAGCCTTGGTCTTCTAACTTTGTCTTCAGCTCAGAAG[T/C]
ACTACACTTCTGAAAAGGGGGAATAATAGCAAGGCTGACTACAACCACCGTACTCAGCAAGCCACACCAATGATGCAAACGTGCAAGGGGATACAAGAAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 45.60% 12.50% 5.37% 36.58% NA
All Indica  2759 23.70% 10.00% 7.29% 58.97% NA
All Japonica  1512 86.00% 7.10% 2.51% 4.37% NA
Aus  269 19.30% 71.70% 4.09% 4.83% NA
Indica I  595 20.00% 2.00% 9.41% 68.57% NA
Indica II  465 34.00% 14.60% 8.17% 43.23% NA
Indica III  913 21.80% 9.10% 4.38% 64.73% NA
Indica Intermediate  786 22.80% 14.40% 8.52% 54.33% NA
Temperate Japonica  767 89.60% 0.10% 4.17% 6.13% NA
Tropical Japonica  504 78.00% 19.60% 0.20% 2.18% NA
Japonica Intermediate  241 91.30% 3.30% 2.07% 3.32% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 57.80% 12.20% 4.44% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507588250 A -> DEL N N silent_mutation Average:8.306; most accessible tissue: Callus, score: 34.302 N N N N
vg0507588250 A -> G LOC_Os05g13690.1 upstream_gene_variant ; 1481.0bp to feature; MODIFIER silent_mutation Average:8.306; most accessible tissue: Callus, score: 34.302 N N N N
vg0507588250 A -> G LOC_Os05g13700.1 upstream_gene_variant ; 3645.0bp to feature; MODIFIER silent_mutation Average:8.306; most accessible tissue: Callus, score: 34.302 N N N N
vg0507588250 A -> G LOC_Os05g13690-LOC_Os05g13700 intergenic_region ; MODIFIER silent_mutation Average:8.306; most accessible tissue: Callus, score: 34.302 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507588250 NA 1.28E-06 mr1207 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 1.85E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 3.06E-06 1.13E-09 mr1278 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 4.40E-07 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 2.43E-06 mr1297 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 2.72E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 9.31E-06 mr1353 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 2.73E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 2.72E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 7.80E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 7.66E-06 mr1474 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 7.66E-06 mr1475 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 4.48E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 1.62E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 7.40E-07 mr1633 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 3.33E-08 mr1764 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 7.75E-06 mr1906 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250 NA 8.98E-07 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251