Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507588250:

Variant ID: vg0507588250 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7588250
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.58, A: 0.42, others allele: 0.00, population size: 97. )

Flanking Sequence (100 bp) in Reference Genome:

ATTCTTGTATCCCCTTGCACGTTTGCATCATTGGTGTGGCTTGCTGAGTACGGTGGTTGTAGTCAGCCTTGCTATTATTCCCCCTTTTCAGAAGTGTAGT[A/G]
CTTCTGAGCTGAAGACAAAGTTAGAAGACCAAGGCTTAGAACCCAGTTGAGTTTTGCCTATGGAGTGGAGCTGAAGCCCCGCTAGGATCGCCTTTTTCCG

Reverse complement sequence

CGGAAAAAGGCGATCCTAGCGGGGCTTCAGCTCCACTCCATAGGCAAAACTCAACTGGGTTCTAAGCCTTGGTCTTCTAACTTTGTCTTCAGCTCAGAAG[T/C]
ACTACACTTCTGAAAAGGGGGAATAATAGCAAGGCTGACTACAACCACCGTACTCAGCAAGCCACACCAATGATGCAAACGTGCAAGGGGATACAAGAAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.60%	12.50%	5.37%	36.58%	NA
All Indica	2759	23.70%	10.00%	7.29%	58.97%	NA
All Japonica	1512	86.00%	7.10%	2.51%	4.37%	NA
Aus	269	19.30%	71.70%	4.09%	4.83%	NA
Indica I	595	20.00%	2.00%	9.41%	68.57%	NA
Indica II	465	34.00%	14.60%	8.17%	43.23%	NA
Indica III	913	21.80%	9.10%	4.38%	64.73%	NA
Indica Intermediate	786	22.80%	14.40%	8.52%	54.33%	NA
Temperate Japonica	767	89.60%	0.10%	4.17%	6.13%	NA
Tropical Japonica	504	78.00%	19.60%	0.20%	2.18%	NA
Japonica Intermediate	241	91.30%	3.30%	2.07%	3.32%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	57.80%	12.20%	4.44%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507588250	A -> DEL	N	N	silent_mutation	Average:8.306; most accessible tissue: Callus, score: 34.302	N	N	N	N
vg0507588250	A -> G	LOC_Os05g13690.1	upstream_gene_variant ; 1481.0bp to feature; MODIFIER	silent_mutation	Average:8.306; most accessible tissue: Callus, score: 34.302	N	N	N	N
vg0507588250	A -> G	LOC_Os05g13700.1	upstream_gene_variant ; 3645.0bp to feature; MODIFIER	silent_mutation	Average:8.306; most accessible tissue: Callus, score: 34.302	N	N	N	N
vg0507588250	A -> G	LOC_Os05g13690-LOC_Os05g13700	intergenic_region ; MODIFIER	silent_mutation	Average:8.306; most accessible tissue: Callus, score: 34.302	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507588250	NA	1.28E-06	mr1207	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	1.85E-06	mr1262	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	3.06E-06	1.13E-09	mr1278	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	4.40E-07	mr1286	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	2.43E-06	mr1297	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	2.72E-06	mr1345	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	9.31E-06	mr1353	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	2.73E-06	mr1365	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	2.72E-06	mr1382	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	7.80E-06	mr1432	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	7.66E-06	mr1474	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	7.66E-06	mr1475	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	4.48E-06	mr1512	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	1.62E-06	mr1556	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	7.40E-07	mr1633	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	3.33E-08	mr1764	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	7.75E-06	mr1906	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507588250	NA	8.98E-07	mr1948	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251