\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507527583:

Variant ID: vg0507527583 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7527583
Reference Allele: GAlternative Allele: C
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.73, G: 0.23, T: 0.04, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CGTGAAGGCGGCGGCTCGGTTTATATAGAGATAGGTCGCTTGATCAGGGCGCCCGCATGATCTCCACTCCACATAACTGAACCGGATAAGTCGCGCGTAA[G/C]
TGTTAACAACCAAATTTGGTAACATTTGTATCAGGAAAGGGGATTTGATCAAAGAAGAGTTGGAGGCGGAGATCGAGTTCTGGAACAGAGCAGGAATCGG

Reverse complement sequence

CCGATTCCTGCTCTGTTCCAGAACTCGATCTCCGCCTCCAACTCTTCTTTGATCAAATCCCCTTTCCTGATACAAATGTTACCAAATTTGGTTGTTAACA[C/G]
TTACGCGCGACTTATCCGGTTCAGTTATGTGGAGTGGAGATCATGCGGGCGCCCTGATCAAGCGACCTATCTCTATATAAACCGAGCCGCCGCCTTCACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 51.80% 47.60% 0.04% 0.57% NA
All Indica  2759 74.90% 24.10% 0.07% 0.87% NA
All Japonica  1512 8.10% 91.70% 0.00% 0.13% NA
Aus  269 81.00% 19.00% 0.00% 0.00% NA
Indica I  595 96.00% 2.70% 0.00% 1.34% NA
Indica II  465 49.90% 48.60% 0.00% 1.51% NA
Indica III  913 69.10% 30.20% 0.11% 0.55% NA
Indica Intermediate  786 80.50% 18.80% 0.13% 0.51% NA
Temperate Japonica  767 1.80% 98.00% 0.00% 0.13% NA
Tropical Japonica  504 19.60% 80.20% 0.00% 0.20% NA
Japonica Intermediate  241 4.10% 95.90% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 40.00% 58.90% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507527583 G -> DEL N N silent_mutation Average:57.256; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0507527583 G -> C LOC_Os05g13570.1 downstream_gene_variant ; 2141.0bp to feature; MODIFIER silent_mutation Average:57.256; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N
vg0507527583 G -> C LOC_Os05g13560-LOC_Os05g13570 intergenic_region ; MODIFIER silent_mutation Average:57.256; most accessible tissue: Zhenshan97 flag leaf, score: 79.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507527583 5.25E-07 8.76E-10 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 6.81E-07 5.99E-08 mr1039 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.94E-09 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 2.96E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.24E-17 mr1133 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 3.05E-13 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 7.78E-08 mr1439 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 4.33E-07 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.10E-14 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.25E-08 mr1660 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.82E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 2.85E-13 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 8.77E-08 2.66E-10 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.96E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 4.49E-15 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 1.82E-06 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 3.07E-08 mr1645_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 7.18E-06 mr1648_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 6.51E-06 mr1840_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 2.13E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 5.24E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507527583 NA 4.06E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251