\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507517974:

Variant ID: vg0507517974 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7517974
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGACGGATCCAGAAAATTAGTTTGTTGGTGTCATAATATGTTTAGTGGTATCATAGTGTGCTAATTATATTTAGATGATAGTGTTATAATATATGGATAA[G/A]
CAGTTTAAGTATGATTTTGTTGAAAGTCATCGGTGTCGCCTGACACCAATGCATATGCTGTAGATCTGTCTCTGCGTGACTTCATGGTTGCGCGACATTC

Reverse complement sequence

GAATGTCGCGCAACCATGAAGTCACGCAGAGACAGATCTACAGCATATGCATTGGTGTCAGGCGACACCGATGACTTTCAACAAAATCATACTTAAACTG[C/T]
TTATCCATATATTATAACACTATCATCTAAATATAATTAGCACACTATGATACCACTAAACATATTATGACACCAACAAACTAATTTTCTGGATCCGTCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 97.50% 1.10% 1.38% 0.00% NA
All Indica  2759 99.80% 0.00% 0.18% 0.00% NA
All Japonica  1512 92.70% 3.40% 3.90% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.00% 0.43% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.60% 0.00% 0.38% 0.00% NA
Temperate Japonica  767 89.00% 5.00% 6.00% 0.00% NA
Tropical Japonica  504 99.40% 0.00% 0.60% 0.00% NA
Japonica Intermediate  241 90.50% 5.40% 4.15% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 1.10% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507517974 G -> A LOC_Os05g13550.1 downstream_gene_variant ; 938.0bp to feature; MODIFIER silent_mutation Average:75.097; most accessible tissue: Callus, score: 88.43 N N N N
vg0507517974 G -> A LOC_Os05g13560.1 downstream_gene_variant ; 3382.0bp to feature; MODIFIER silent_mutation Average:75.097; most accessible tissue: Callus, score: 88.43 N N N N
vg0507517974 G -> A LOC_Os05g13540-LOC_Os05g13550 intergenic_region ; MODIFIER silent_mutation Average:75.097; most accessible tissue: Callus, score: 88.43 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507517974 3.62E-08 3.62E-08 mr1024_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 NA 1.20E-06 mr1092_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 NA 2.09E-06 mr1097_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 NA 6.49E-06 mr1152_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 2.22E-06 2.22E-06 mr1317_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 5.64E-08 9.60E-10 mr1565_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 2.73E-06 2.73E-06 mr1897_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 3.76E-06 3.75E-06 mr1914_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 NA 4.82E-06 mr1922_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974 6.92E-07 6.92E-07 mr1940_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251