Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507517974:

Variant ID: vg0507517974 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7517974
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGACGGATCCAGAAAATTAGTTTGTTGGTGTCATAATATGTTTAGTGGTATCATAGTGTGCTAATTATATTTAGATGATAGTGTTATAATATATGGATAA[G/A]
CAGTTTAAGTATGATTTTGTTGAAAGTCATCGGTGTCGCCTGACACCAATGCATATGCTGTAGATCTGTCTCTGCGTGACTTCATGGTTGCGCGACATTC

Reverse complement sequence

GAATGTCGCGCAACCATGAAGTCACGCAGAGACAGATCTACAGCATATGCATTGGTGTCAGGCGACACCGATGACTTTCAACAAAATCATACTTAAACTG[C/T]
TTATCCATATATTATAACACTATCATCTAAATATAATTAGCACACTATGATACCACTAAACATATTATGACACCAACAAACTAATTTTCTGGATCCGTCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.50%	1.10%	1.38%	0.00%	NA
All Indica	2759	99.80%	0.00%	0.18%	0.00%	NA
All Japonica	1512	92.70%	3.40%	3.90%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	99.60%	0.00%	0.43%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.00%	0.38%	0.00%	NA
Temperate Japonica	767	89.00%	5.00%	6.00%	0.00%	NA
Tropical Japonica	504	99.40%	0.00%	0.60%	0.00%	NA
Japonica Intermediate	241	90.50%	5.40%	4.15%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	97.80%	1.10%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507517974	G -> A	LOC_Os05g13550.1	downstream_gene_variant ; 938.0bp to feature; MODIFIER	silent_mutation	Average:75.097; most accessible tissue: Callus, score: 88.43	N	N	N	N
vg0507517974	G -> A	LOC_Os05g13560.1	downstream_gene_variant ; 3382.0bp to feature; MODIFIER	silent_mutation	Average:75.097; most accessible tissue: Callus, score: 88.43	N	N	N	N
vg0507517974	G -> A	LOC_Os05g13540-LOC_Os05g13550	intergenic_region ; MODIFIER	silent_mutation	Average:75.097; most accessible tissue: Callus, score: 88.43	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507517974	3.62E-08	3.62E-08	mr1024_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	NA	1.20E-06	mr1092_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	NA	2.09E-06	mr1097_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	NA	6.49E-06	mr1152_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	2.22E-06	2.22E-06	mr1317_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	5.64E-08	9.60E-10	mr1565_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	2.73E-06	2.73E-06	mr1897_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	3.76E-06	3.75E-06	mr1914_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	NA	4.82E-06	mr1922_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507517974	6.92E-07	6.92E-07	mr1940_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251