\
| Variant ID: vg0507517974 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7517974 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CGACGGATCCAGAAAATTAGTTTGTTGGTGTCATAATATGTTTAGTGGTATCATAGTGTGCTAATTATATTTAGATGATAGTGTTATAATATATGGATAA[G/A]
CAGTTTAAGTATGATTTTGTTGAAAGTCATCGGTGTCGCCTGACACCAATGCATATGCTGTAGATCTGTCTCTGCGTGACTTCATGGTTGCGCGACATTC
GAATGTCGCGCAACCATGAAGTCACGCAGAGACAGATCTACAGCATATGCATTGGTGTCAGGCGACACCGATGACTTTCAACAAAATCATACTTAAACTG[C/T]
TTATCCATATATTATAACACTATCATCTAAATATAATTAGCACACTATGATACCACTAAACATATTATGACACCAACAAACTAATTTTCTGGATCCGTCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 97.50% | 1.10% | 1.38% | 0.00% | NA |
| All Indica | 2759 | 99.80% | 0.00% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 92.70% | 3.40% | 3.90% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.00% | 0.43% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.00% | 0.38% | 0.00% | NA |
| Temperate Japonica | 767 | 89.00% | 5.00% | 6.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.40% | 0.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 90.50% | 5.40% | 4.15% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 1.10% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507517974 | G -> A | LOC_Os05g13550.1 | downstream_gene_variant ; 938.0bp to feature; MODIFIER | silent_mutation | Average:75.097; most accessible tissue: Callus, score: 88.43 | N | N | N | N |
| vg0507517974 | G -> A | LOC_Os05g13560.1 | downstream_gene_variant ; 3382.0bp to feature; MODIFIER | silent_mutation | Average:75.097; most accessible tissue: Callus, score: 88.43 | N | N | N | N |
| vg0507517974 | G -> A | LOC_Os05g13540-LOC_Os05g13550 | intergenic_region ; MODIFIER | silent_mutation | Average:75.097; most accessible tissue: Callus, score: 88.43 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507517974 | 3.62E-08 | 3.62E-08 | mr1024_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | NA | 1.20E-06 | mr1092_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | NA | 2.09E-06 | mr1097_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | NA | 6.49E-06 | mr1152_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | 2.22E-06 | 2.22E-06 | mr1317_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | 5.64E-08 | 9.60E-10 | mr1565_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | 2.73E-06 | 2.73E-06 | mr1897_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | 3.76E-06 | 3.75E-06 | mr1914_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | NA | 4.82E-06 | mr1922_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507517974 | 6.92E-07 | 6.92E-07 | mr1940_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |