\
| Variant ID: vg0507386923 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7386923 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, C: 0.00, others allele: 0.00, population size: 259. )
CGGGGTCCAAATTTACCCCTAGCTAGTTCCAGGGATTTTGGTCCACGCAGAAACTGATCTTTTTCAATCTCTACTTGATACTTGAATAATGTCTCGGGGA[A/C]
ATTTAATTTAGTTTCAAAACCCTGATGCCTGCAGGGTCTAAATTATAAAAACATTTCCATAGTAGAACATAAACACAGAAAAAGAAAATGGAGAAGAACT
AGTTCTTCTCCATTTTCTTTTTCTGTGTTTATGTTCTACTATGGAAATGTTTTTATAATTTAGACCCTGCAGGCATCAGGGTTTTGAAACTAAATTAAAT[T/G]
TCCCCGAGACATTATTCAAGTATCAAGTAGAGATTGAAAAAGATCAGTTTCTGCGTGGACCAAAATCCCTGGAACTAGCTAGGGGTAAATTTGGACCCCG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 66.10% | 33.60% | 0.25% | 0.08% | NA |
| All Indica | 2759 | 79.80% | 19.80% | 0.29% | 0.14% | NA |
| All Japonica | 1512 | 36.80% | 63.00% | 0.13% | 0.00% | NA |
| Aus | 269 | 84.80% | 15.20% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 52.90% | 46.20% | 0.65% | 0.22% | NA |
| Indica III | 913 | 78.00% | 21.60% | 0.33% | 0.11% | NA |
| Indica Intermediate | 786 | 83.30% | 16.20% | 0.25% | 0.25% | NA |
| Temperate Japonica | 767 | 52.40% | 47.60% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.20% | 78.60% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 19.90% | 79.70% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 88.50% | 11.50% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 58.90% | 38.90% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507386923 | A -> DEL | N | N | silent_mutation | Average:71.895; most accessible tissue: Zhenshan97 flower, score: 82.948 | N | N | N | N |
| vg0507386923 | A -> C | LOC_Os05g13320-LOC_Os05g13330 | intergenic_region ; MODIFIER | silent_mutation | Average:71.895; most accessible tissue: Zhenshan97 flower, score: 82.948 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507386923 | 5.67E-06 | 1.41E-11 | mr1039 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 6.46E-10 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 1.26E-15 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | 9.50E-09 | 6.06E-13 | mr1039_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 1.68E-06 | mr1188_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 4.22E-08 | mr1378_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 9.54E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 3.08E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 9.68E-13 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 3.05E-15 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | 4.05E-08 | 1.83E-09 | mr1632_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 6.97E-06 | mr1875_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507386923 | NA | 7.24E-07 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |