\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507356168:

Variant ID: vg0507356168 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7356168
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 241. )

Flanking Sequence (100 bp) in Reference Genome:


GGTCCTCACCAATCTTCCTCTTTGGAGAGAGCCAGGTCGATGGCGAGACATTCCCATATTTGTACAAAATCCAGGGTGTGTTTAGTTCACGCTAAAATTG[G/A]
AATATTGGTTGAAATTGGAACGATGTGACGGAAAAGTTGGAAGTTTATGTGTAGGAAAGTTTTAATGTGATGGAAAATTAGAAGTTTGAAGAAAAAGTTT

Reverse complement sequence

AAACTTTTTCTTCAAACTTCTAATTTTCCATCACATTAAAACTTTCCTACACATAAACTTCCAACTTTTCCGTCACATCGTTCCAATTTCAACCAATATT[C/T]
CAATTTTAGCGTGAACTAAACACACCCTGGATTTTGTACAAATATGGGAATGTCTCGCCATCGACCTGGCTCTCTCCAAAGAGGAAGATTGGTGAGGACC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.50% 28.20% 0.11% 0.19% NA
All Indica  2759 78.80% 20.80% 0.14% 0.25% NA
All Japonica  1512 55.40% 44.40% 0.07% 0.13% NA
Aus  269 84.80% 15.20% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 53.10% 46.50% 0.22% 0.22% NA
Indica III  913 74.80% 24.60% 0.22% 0.33% NA
Indica Intermediate  786 83.50% 16.00% 0.13% 0.38% NA
Temperate Japonica  767 81.50% 18.40% 0.13% 0.00% NA
Tropical Japonica  504 27.00% 72.80% 0.00% 0.20% NA
Japonica Intermediate  241 31.50% 68.00% 0.00% 0.41% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 62.20% 37.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507356168 G -> DEL N N silent_mutation Average:44.224; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0507356168 G -> A LOC_Os05g12804.1 upstream_gene_variant ; 4412.0bp to feature; MODIFIER silent_mutation Average:44.224; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0507356168 G -> A LOC_Os05g12808.1 downstream_gene_variant ; 614.0bp to feature; MODIFIER silent_mutation Average:44.224; most accessible tissue: Minghui63 flower, score: 61.616 N N N N
vg0507356168 G -> A LOC_Os05g12804-LOC_Os05g12808 intergenic_region ; MODIFIER silent_mutation Average:44.224; most accessible tissue: Minghui63 flower, score: 61.616 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507356168 1.47E-06 7.35E-11 mr1039 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 2.63E-06 mr1180 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 3.26E-06 mr1183 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 6.30E-08 2.45E-22 mr1593 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 2.14E-16 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 4.62E-07 6.19E-16 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 1.12E-07 mr1668 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 1.88E-08 5.21E-12 mr1039_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 3.24E-06 mr1188_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 9.97E-06 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 4.33E-06 1.03E-24 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 1.10E-15 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 2.96E-06 NA mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 3.09E-06 3.83E-08 mr1632_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 6.48E-06 mr1875_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507356168 NA 6.85E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251