\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507301196:

Variant ID: vg0507301196 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7301196
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CATGCGAGTTTTTTAAACATATTTCTTATATAATTTTCTCTGTATTACCAAAAGTGAACGATCTTAATAACCGACTCAAATATGGATATATAACCAAAAG[C/G]
AAACGAACTTAAAAACCGACTCATACACGGATGACGTACCAAAATACCGACAAAAACATCTTCAATTTTTATAACCGACTCAAACACGAATGATGGACCG

Reverse complement sequence

CGGTCCATCATTCGTGTTTGAGTCGGTTATAAAAATTGAAGATGTTTTTGTCGGTATTTTGGTACGTCATCCGTGTATGAGTCGGTTTTTAAGTTCGTTT[G/C]
CTTTTGGTTATATATCCATATTTGAGTCGGTTATTAAGATCGTTCACTTTTGGTAATACAGAGAAAATTATATAAGAAATATGTTTAAAAAACTCGCATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.40% 3.90% 1.76% 0.00% NA
All Indica  2759 90.40% 6.60% 2.97% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 92.60% 0.80% 6.55% 0.00% NA
Indica II  465 92.30% 5.80% 1.94% 0.00% NA
Indica III  913 92.30% 6.90% 0.77% 0.00% NA
Indica Intermediate  786 85.50% 11.10% 3.44% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 97.80% 2.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507301196 C -> G LOC_Os05g12710.1 upstream_gene_variant ; 2146.0bp to feature; MODIFIER silent_mutation Average:22.922; most accessible tissue: Callus, score: 41.802 N N N N
vg0507301196 C -> G LOC_Os05g12720.1 upstream_gene_variant ; 3325.0bp to feature; MODIFIER silent_mutation Average:22.922; most accessible tissue: Callus, score: 41.802 N N N N
vg0507301196 C -> G LOC_Os05g12730.1 downstream_gene_variant ; 4614.0bp to feature; MODIFIER silent_mutation Average:22.922; most accessible tissue: Callus, score: 41.802 N N N N
vg0507301196 C -> G LOC_Os05g12710-LOC_Os05g12720 intergenic_region ; MODIFIER silent_mutation Average:22.922; most accessible tissue: Callus, score: 41.802 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507301196 NA 4.60E-06 mr1228 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 NA 6.91E-07 mr1229 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 NA 7.31E-06 mr1265 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 4.78E-06 3.45E-07 mr1265 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 1.42E-06 1.42E-06 mr1393 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 8.95E-06 8.95E-06 mr1464 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 NA 6.86E-07 mr1528 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 3.40E-06 3.90E-06 mr1614 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 NA 8.69E-07 mr1730 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 1.07E-06 1.01E-06 mr1775 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507301196 1.88E-06 1.88E-06 mr1866 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251