\
| Variant ID: vg0507301196 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7301196 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 123. )
CATGCGAGTTTTTTAAACATATTTCTTATATAATTTTCTCTGTATTACCAAAAGTGAACGATCTTAATAACCGACTCAAATATGGATATATAACCAAAAG[C/G]
AAACGAACTTAAAAACCGACTCATACACGGATGACGTACCAAAATACCGACAAAAACATCTTCAATTTTTATAACCGACTCAAACACGAATGATGGACCG
CGGTCCATCATTCGTGTTTGAGTCGGTTATAAAAATTGAAGATGTTTTTGTCGGTATTTTGGTACGTCATCCGTGTATGAGTCGGTTTTTAAGTTCGTTT[G/C]
CTTTTGGTTATATATCCATATTTGAGTCGGTTATTAAGATCGTTCACTTTTGGTAATACAGAGAAAATTATATAAGAAATATGTTTAAAAAACTCGCATG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.40% | 3.90% | 1.76% | 0.00% | NA |
| All Indica | 2759 | 90.40% | 6.60% | 2.97% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 92.60% | 0.80% | 6.55% | 0.00% | NA |
| Indica II | 465 | 92.30% | 5.80% | 1.94% | 0.00% | NA |
| Indica III | 913 | 92.30% | 6.90% | 0.77% | 0.00% | NA |
| Indica Intermediate | 786 | 85.50% | 11.10% | 3.44% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 97.80% | 2.20% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507301196 | C -> G | LOC_Os05g12710.1 | upstream_gene_variant ; 2146.0bp to feature; MODIFIER | silent_mutation | Average:22.922; most accessible tissue: Callus, score: 41.802 | N | N | N | N |
| vg0507301196 | C -> G | LOC_Os05g12720.1 | upstream_gene_variant ; 3325.0bp to feature; MODIFIER | silent_mutation | Average:22.922; most accessible tissue: Callus, score: 41.802 | N | N | N | N |
| vg0507301196 | C -> G | LOC_Os05g12730.1 | downstream_gene_variant ; 4614.0bp to feature; MODIFIER | silent_mutation | Average:22.922; most accessible tissue: Callus, score: 41.802 | N | N | N | N |
| vg0507301196 | C -> G | LOC_Os05g12710-LOC_Os05g12720 | intergenic_region ; MODIFIER | silent_mutation | Average:22.922; most accessible tissue: Callus, score: 41.802 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507301196 | NA | 4.60E-06 | mr1228 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | NA | 6.91E-07 | mr1229 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | NA | 7.31E-06 | mr1265 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | 4.78E-06 | 3.45E-07 | mr1265 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | 1.42E-06 | 1.42E-06 | mr1393 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | 8.95E-06 | 8.95E-06 | mr1464 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | NA | 6.86E-07 | mr1528 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | 3.40E-06 | 3.90E-06 | mr1614 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | NA | 8.69E-07 | mr1730 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | 1.07E-06 | 1.01E-06 | mr1775 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507301196 | 1.88E-06 | 1.88E-06 | mr1866 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |