\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507296732:

Variant ID: vg0507296732 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7296732
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:


GAGAAGAAGGGAAGGAGAAAGGGGAGAAGAGGGAGGAGTATAGAGGGAGGGGGGCAAACCGATCGCTGGGTGATCGCCCTGGCGATCGATCGCCCATTAG[C/T]
CTCCCCCGTTTGATCGTGTCACTGGGAATTTTTTTATTTTTACATTTTTTATTACTAGAAAAAATGTCCGTGCGTAGCAATGGGTGAAGTCTATTTTAAC

Reverse complement sequence

GTTAAAATAGACTTCACCCATTGCTACGCACGGACATTTTTTCTAGTAATAAAAAATGTAAAAATAAAAAAATTCCCAGTGACACGATCAAACGGGGGAG[G/A]
CTAATGGGCGATCGATCGCCAGGGCGATCACCCAGCGATCGGTTTGCCCCCCTCCCTCTATACTCCTCCCTCTTCTCCCCTTTCTCCTTCCCTTCTTCTC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.70% 40.10% 0.25% 0.00% NA
All Indica  2759 40.40% 59.30% 0.29% 0.00% NA
All Japonica  1512 98.10% 1.70% 0.20% 0.00% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 19.50% 80.30% 0.17% 0.00% NA
Indica II  465 74.80% 25.20% 0.00% 0.00% NA
Indica III  913 40.30% 59.40% 0.33% 0.00% NA
Indica Intermediate  786 36.00% 63.50% 0.51% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.40% 0.40% 0.00% NA
Japonica Intermediate  241 95.90% 3.70% 0.41% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 75.60% 23.30% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507296732 C -> T LOC_Os05g12700.1 upstream_gene_variant ; 4881.0bp to feature; MODIFIER silent_mutation Average:53.889; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0507296732 C -> T LOC_Os05g12710.1 downstream_gene_variant ; 1904.0bp to feature; MODIFIER silent_mutation Average:53.889; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0507296732 C -> T LOC_Os05g12700-LOC_Os05g12710 intergenic_region ; MODIFIER silent_mutation Average:53.889; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507296732 NA 4.58E-10 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 8.40E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 5.89E-13 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 1.71E-06 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 2.00E-06 2.87E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 1.45E-15 5.37E-20 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 7.68E-19 5.19E-41 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 9.52E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 3.90E-08 9.29E-31 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 8.39E-10 1.07E-21 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 9.80E-06 mr1296_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 1.54E-10 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 1.03E-06 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 6.77E-11 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 6.35E-09 mr1482_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 5.47E-08 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 2.86E-21 2.10E-28 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 2.17E-25 9.76E-54 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 1.84E-07 mr1654_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 8.63E-06 mr1735_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 5.45E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 1.95E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 5.01E-10 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732 NA 4.03E-06 mr1882_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251