Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507296732:

Variant ID: vg0507296732 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7296732
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GAGAAGAAGGGAAGGAGAAAGGGGAGAAGAGGGAGGAGTATAGAGGGAGGGGGGCAAACCGATCGCTGGGTGATCGCCCTGGCGATCGATCGCCCATTAG[C/T]
CTCCCCCGTTTGATCGTGTCACTGGGAATTTTTTTATTTTTACATTTTTTATTACTAGAAAAAATGTCCGTGCGTAGCAATGGGTGAAGTCTATTTTAAC

Reverse complement sequence

GTTAAAATAGACTTCACCCATTGCTACGCACGGACATTTTTTCTAGTAATAAAAAATGTAAAAATAAAAAAATTCCCAGTGACACGATCAAACGGGGGAG[G/A]
CTAATGGGCGATCGATCGCCAGGGCGATCACCCAGCGATCGGTTTGCCCCCCTCCCTCTATACTCCTCCCTCTTCTCCCCTTTCTCCTTCCCTTCTTCTC

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	59.70%	40.10%	0.25%	0.00%	NA
All Indica	2759	40.40%	59.30%	0.29%	0.00%	NA
All Japonica	1512	98.10%	1.70%	0.20%	0.00%	NA
Aus	269	21.90%	78.10%	0.00%	0.00%	NA
Indica I	595	19.50%	80.30%	0.17%	0.00%	NA
Indica II	465	74.80%	25.20%	0.00%	0.00%	NA
Indica III	913	40.30%	59.40%	0.33%	0.00%	NA
Indica Intermediate	786	36.00%	63.50%	0.51%	0.00%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	96.20%	3.40%	0.40%	0.00%	NA
Japonica Intermediate	241	95.90%	3.70%	0.41%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	75.60%	23.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507296732	C -> T	LOC_Os05g12700.1	upstream_gene_variant ; 4881.0bp to feature; MODIFIER	silent_mutation	Average:53.889; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0507296732	C -> T	LOC_Os05g12710.1	downstream_gene_variant ; 1904.0bp to feature; MODIFIER	silent_mutation	Average:53.889; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N
vg0507296732	C -> T	LOC_Os05g12700-LOC_Os05g12710	intergenic_region ; MODIFIER	silent_mutation	Average:53.889; most accessible tissue: Zhenshan97 panicle, score: 71.253	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507296732	NA	4.58E-10	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	8.40E-07	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	5.89E-13	mr1272	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	1.71E-06	NA	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	2.00E-06	2.87E-10	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	1.45E-15	5.37E-20	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	7.68E-19	5.19E-41	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	9.52E-12	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	3.90E-08	9.29E-31	mr1195_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	8.39E-10	1.07E-21	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	9.80E-06	mr1296_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	1.54E-10	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	1.03E-06	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	6.77E-11	mr1482_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	6.35E-09	mr1482_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	5.47E-08	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	2.86E-21	2.10E-28	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	2.17E-25	9.76E-54	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	1.84E-07	mr1654_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	8.63E-06	mr1735_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	5.45E-09	mr1748_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	1.95E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	5.01E-10	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507296732	NA	4.03E-06	mr1882_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251