\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507293858:

Variant ID: vg0507293858 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7293858
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:


TCGTGATCTCCTCACACCCGCCGGCCTCGCTGCCACTGCATCGGCCTCCGTCCAGCGCCCGCGCCCCTCGCCGCGCCTCGCTCACCTCTACTCGGACTCG[C/T]
GCGCGTGGGAAATGAGAAGGGGATCGATGGGGGAGAGATTAGGCTGACAAGTTGGTCTGCTGTTATTTTAGAGAGGAGTAATAGAGAGTCTGTTGGAGTG

Reverse complement sequence

CACTCCAACAGACTCTCTATTACTCCTCTCTAAAATAACAGCAGACCAACTTGTCAGCCTAATCTCTCCCCCATCGATCCCCTTCTCATTTCCCACGCGC[G/A]
CGAGTCCGAGTAGAGGTGAGCGAGGCGCGGCGAGGGGCGCGGGCGCTGGACGGAGGCCGATGCAGTGGCAGCGAGGCCGGCGGGTGTGAGGAGATCACGA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.80% 38.80% 0.42% 0.00% NA
All Indica  2759 61.60% 37.90% 0.54% 0.00% NA
All Japonica  1512 54.80% 45.00% 0.26% 0.00% NA
Aus  269 80.70% 19.30% 0.00% 0.00% NA
Indica I  595 82.40% 17.60% 0.00% 0.00% NA
Indica II  465 27.30% 72.00% 0.65% 0.00% NA
Indica III  913 62.00% 37.30% 0.66% 0.00% NA
Indica Intermediate  786 65.60% 33.60% 0.76% 0.00% NA
Temperate Japonica  767 90.90% 9.10% 0.00% 0.00% NA
Tropical Japonica  504 9.90% 89.70% 0.40% 0.00% NA
Japonica Intermediate  241 33.60% 65.60% 0.83% 0.00% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 51.10% 47.80% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507293858 C -> T LOC_Os05g12700.1 upstream_gene_variant ; 2007.0bp to feature; MODIFIER silent_mutation Average:75.047; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0507293858 C -> T LOC_Os05g12710.1 downstream_gene_variant ; 4778.0bp to feature; MODIFIER silent_mutation Average:75.047; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N
vg0507293858 C -> T LOC_Os05g12700-LOC_Os05g12710 intergenic_region ; MODIFIER silent_mutation Average:75.047; most accessible tissue: Minghui63 panicle, score: 85.556 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507293858 NA 1.74E-15 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507293858 NA 1.60E-06 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 1.22E-06 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 3.12E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 8.61E-07 3.25E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 1.26E-26 2.53E-53 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 3.35E-22 9.31E-47 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 1.52E-09 2.08E-27 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 6.58E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 3.07E-09 NA mr1195_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 3.23E-09 3.85E-20 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 2.87E-08 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 5.47E-09 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 5.48E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 5.30E-07 mr1428_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 3.13E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 1.91E-07 mr1517_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 1.80E-07 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 1.33E-32 7.45E-69 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 4.01E-29 2.02E-60 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 3.41E-12 4.43E-38 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 2.86E-09 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 1.66E-09 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 9.37E-06 mr1756_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 5.26E-17 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 6.62E-06 1.46E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 7.23E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858 NA 8.00E-06 mr1961_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251