Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507293858:

Variant ID: vg0507293858 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7293858
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 112. )

Flanking Sequence (100 bp) in Reference Genome:

TCGTGATCTCCTCACACCCGCCGGCCTCGCTGCCACTGCATCGGCCTCCGTCCAGCGCCCGCGCCCCTCGCCGCGCCTCGCTCACCTCTACTCGGACTCG[C/T]
GCGCGTGGGAAATGAGAAGGGGATCGATGGGGGAGAGATTAGGCTGACAAGTTGGTCTGCTGTTATTTTAGAGAGGAGTAATAGAGAGTCTGTTGGAGTG

Reverse complement sequence

CACTCCAACAGACTCTCTATTACTCCTCTCTAAAATAACAGCAGACCAACTTGTCAGCCTAATCTCTCCCCCATCGATCCCCTTCTCATTTCCCACGCGC[G/A]
CGAGTCCGAGTAGAGGTGAGCGAGGCGCGGCGAGGGGCGCGGGCGCTGGACGGAGGCCGATGCAGTGGCAGCGAGGCCGGCGGGTGTGAGGAGATCACGA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.80%	38.80%	0.42%	0.00%	NA
All Indica	2759	61.60%	37.90%	0.54%	0.00%	NA
All Japonica	1512	54.80%	45.00%	0.26%	0.00%	NA
Aus	269	80.70%	19.30%	0.00%	0.00%	NA
Indica I	595	82.40%	17.60%	0.00%	0.00%	NA
Indica II	465	27.30%	72.00%	0.65%	0.00%	NA
Indica III	913	62.00%	37.30%	0.66%	0.00%	NA
Indica Intermediate	786	65.60%	33.60%	0.76%	0.00%	NA
Temperate Japonica	767	90.90%	9.10%	0.00%	0.00%	NA
Tropical Japonica	504	9.90%	89.70%	0.40%	0.00%	NA
Japonica Intermediate	241	33.60%	65.60%	0.83%	0.00%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	51.10%	47.80%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507293858	C -> T	LOC_Os05g12700.1	upstream_gene_variant ; 2007.0bp to feature; MODIFIER	silent_mutation	Average:75.047; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0507293858	C -> T	LOC_Os05g12710.1	downstream_gene_variant ; 4778.0bp to feature; MODIFIER	silent_mutation	Average:75.047; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N
vg0507293858	C -> T	LOC_Os05g12700-LOC_Os05g12710	intergenic_region ; MODIFIER	silent_mutation	Average:75.047; most accessible tissue: Minghui63 panicle, score: 85.556	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507293858	NA	1.74E-15	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507293858	NA	1.60E-06	mr1050	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	1.22E-06	mr1272	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	3.12E-07	NA	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	8.61E-07	3.25E-10	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	1.26E-26	2.53E-53	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	3.35E-22	9.31E-47	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	1.52E-09	2.08E-27	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	6.58E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	3.07E-09	NA	mr1195_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	3.23E-09	3.85E-20	mr1195_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	2.87E-08	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	5.47E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	5.48E-07	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	5.30E-07	mr1428_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	3.13E-07	mr1482_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	1.91E-07	mr1517_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	1.80E-07	mr1531_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	1.33E-32	7.45E-69	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	4.01E-29	2.02E-60	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	3.41E-12	4.43E-38	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	2.86E-09	mr1627_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	1.66E-09	mr1715_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	9.37E-06	mr1756_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	5.26E-17	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	6.62E-06	1.46E-11	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	7.23E-06	mr1866_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507293858	NA	8.00E-06	mr1961_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251