RiceVarMap2

Detailed information for vg0507287869:

Variant ID: vg0507287869 (JBrowse)

Variation Type: SNP

Chromosome: chr05

Position: 7287869

Reference Allele: C

Alternative Allele: T

Primary Allele: C

Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCACATTATCAAATATGGGAGCAATTAGCAGACTTGTCTTGCAATTTACACGTAATCTGTGTAATTAGTTATTTTTTCGTTTATATTTAATATTGCATG[C/T]
ATGTGTCCAAACATTCGATGTGATAGGGTGAAAAATTTTGCCGGAGAATCTAAACATGCCCTTATTTCATTTGCTACTACTCCTTCCGTTTCTAAATATT

Reverse complement sequence

AATATTTAGAAACGGAAGGAGTAGTAGCAAATGAAATAAGGGCATGTTTAGATTCTCCGGCAAAATTTTTCACCCTATCACATCGAATGTTTGGACACAT[G/A]
CATGCAATATTAAATATAAACGAAAAAATAACTAATTACACAGATTACGTGTAAATTGCAAGACAAGTCTGCTAATTGCTCCCATATTTGATAATGTGGT

Allele Frequencies:

Search:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	96.20%	3.70%	0.11%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	94.50%	5.20%	0.33%	0.00%	NA
Aus	269	99.60%	0.40%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.30%	0.70%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.40%	0.00%	0.00%	NA
Temperate Japonica	767	92.00%	7.30%	0.65%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	90.90%	9.10%	0.00%	0.00%	NA
VI/Aromatic	96	18.80%	81.20%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507287869	C -> T	LOC_Os05g12680.1	upstream_gene_variant ; 3199.0bp to feature; MODIFIER	silent_mutation	Average:55.169; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0507287869	C -> T	LOC_Os05g12700.1	downstream_gene_variant ; 759.0bp to feature; MODIFIER	silent_mutation	Average:55.169; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N
vg0507287869	C -> T	LOC_Os05g12680-LOC_Os05g12700	intergenic_region ; MODIFIER	silent_mutation	Average:55.169; most accessible tissue: Minghui63 panicle, score: 68.46	N	N	N	N

Showing 1 to 3 of 3 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507287869	4.41E-06	5.37E-09	mr1679	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287869	NA	5.34E-06	mr1691	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 2 of 2 entries

Previous1Next

Contact

Address: Room B111, National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural university, Wuhan, 430070, China

Comments or Questions? Please contact us. Our website: http://xielab.ncpgr.cn/

Search for Variation information by Variation ID:

Detailed information for vg0507287869:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact