Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507287653:

Variant ID: vg0507287653 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7287653
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, T: 0.00, others allele: 0.00, population size: 236. )

Flanking Sequence (100 bp) in Reference Genome:

TTACTGGCAGACTGGCTACATCAACGAAAAGCCATTGCTTAGGCTGTGTTCAGACCCAGGGTGAAAAGTTTTGGCGTGTCACATTAGATATACGGACACA[C/T]
ATTTAAAGTATTAAACATAGACTAATAACAAAACAAATTACAGATTTCGCCTGTAAACTACAAGACGAATTTATTAAGCCAAATTAATTTGTCATTAGCA

Reverse complement sequence

TGCTAATGACAAATTAATTTGGCTTAATAAATTCGTCTTGTAGTTTACAGGCGAAATCTGTAATTTGTTTTGTTATTAGTCTATGTTTAATACTTTAAAT[G/A]
TGTGTCCGTATATCTAATGTGACACGCCAAAACTTTTCACCCTGGGTCTGAACACAGCCTAAGCAATGGCTTTTCGTTGATGTAGCCAGTCTGCCAGTAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	47.70%	46.90%	4.36%	1.02%	NA
All Indica	2759	39.50%	52.50%	7.07%	0.87%	NA
All Japonica	1512	54.40%	45.00%	0.20%	0.33%	NA
Aus	269	80.70%	11.20%	1.49%	6.69%	NA
Indica I	595	19.30%	57.50%	23.19%	0.00%	NA
Indica II	465	23.20%	74.80%	1.29%	0.65%	NA
Indica III	913	53.20%	44.10%	1.20%	1.42%	NA
Indica Intermediate	786	48.60%	45.30%	5.09%	1.02%	NA
Temperate Japonica	767	91.00%	9.00%	0.00%	0.00%	NA
Tropical Japonica	504	9.10%	90.10%	0.20%	0.60%	NA
Japonica Intermediate	241	32.80%	65.60%	0.83%	0.83%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	45.60%	48.90%	4.44%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507287653	C -> T	LOC_Os05g12680.1	upstream_gene_variant ; 2983.0bp to feature; MODIFIER	silent_mutation	Average:71.507; most accessible tissue: Minghui63 root, score: 86.705	N	N	N	N
vg0507287653	C -> T	LOC_Os05g12700.1	downstream_gene_variant ; 975.0bp to feature; MODIFIER	silent_mutation	Average:71.507; most accessible tissue: Minghui63 root, score: 86.705	N	N	N	N
vg0507287653	C -> T	LOC_Os05g12680-LOC_Os05g12700	intergenic_region ; MODIFIER	silent_mutation	Average:71.507; most accessible tissue: Minghui63 root, score: 86.705	N	N	N	N
vg0507287653	C -> DEL	N	N	silent_mutation	Average:71.507; most accessible tissue: Minghui63 root, score: 86.705	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0507287653	C	T	-0.01	-0.03	-0.04	-0.02	-0.03	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507287653	NA	2.15E-16	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507287653	NA	6.92E-08	mr1403	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	3.22E-11	3.12E-18	mr1593	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	4.04E-06	1.22E-10	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	8.56E-11	3.92E-28	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	1.88E-07	mr1916	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	6.90E-08	mr1133_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	9.82E-09	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	1.77E-07	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	8.61E-11	2.46E-21	mr1593_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	5.66E-11	mr1593_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	4.51E-13	3.00E-39	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	2.52E-19	mr1807_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507287653	NA	1.80E-07	mr1807_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251