Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507254337:

Variant ID: vg0507254337 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7254337
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GGCCTGGGCGATCGGAGCCAGGCATGGGTCAGCGGAACCCAAGGTTGGCCGAACCGTGGTTGGCCTCCCTGGGCCAGTCCTTCGTCCTAGACGTCTCCTG[A/G]
CAGATCCTCGGCCCAGTGGCATAGTGGTTGGGCCCATTTGTAGGTGTTTCAATGAGATTCTGGGCACATCCATCCATATATCTGCCACATGTCGACCTCT

Reverse complement sequence

AGAGGTCGACATGTGGCAGATATATGGATGGATGTGCCCAGAATCTCATTGAAACACCTACAAATGGGCCCAACCACTATGCCACTGGGCCGAGGATCTG[T/C]
CAGGAGACGTCTAGGACGAAGGACTGGCCCAGGGAGGCCAACCACGGTTCGGCCAACCTTGGGTTCCGCTGACCCATGCCTGGCTCCGATCGCCCAGGCC

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	54.40%	6.90%	1.06%	37.60%	NA
All Indica	2759	57.70%	5.60%	0.87%	35.81%	NA
All Japonica	1512	57.10%	0.60%	1.26%	41.01%	NA
Aus	269	21.90%	58.00%	1.86%	18.22%	NA
Indica I	595	73.10%	10.10%	0.00%	16.81%	NA
Indica II	465	29.70%	0.20%	2.80%	67.31%	NA
Indica III	913	59.30%	4.20%	0.22%	36.36%	NA
Indica Intermediate	786	60.80%	7.10%	1.15%	30.92%	NA
Temperate Japonica	767	91.50%	0.40%	0.39%	7.69%	NA
Tropical Japonica	504	13.10%	0.40%	1.98%	84.52%	NA
Japonica Intermediate	241	39.80%	1.70%	2.49%	56.02%	NA
VI/Aromatic	96	13.50%	2.10%	2.08%	82.29%	NA
Intermediate	90	47.80%	6.70%	0.00%	45.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507254337	A -> DEL	N	N	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12640.1	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12640.2	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12640.4	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12640.6	upstream_gene_variant ; 1172.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12640.3	upstream_gene_variant ; 1174.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12630.1	downstream_gene_variant ; 2940.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12630.2	downstream_gene_variant ; 2940.0bp to feature; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N
vg0507254337	A -> G	LOC_Os05g12630-LOC_Os05g12640	intergenic_region ; MODIFIER	silent_mutation	Average:54.414; most accessible tissue: Zhenshan97 young leaf, score: 86.383	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0507254337	A	G	0.0	0.01	0.01	-0.01	0.0	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507254337	8.27E-06	7.81E-08	mr1039	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507254337	NA	2.24E-06	mr1397	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507254337	9.25E-07	NA	mr1039_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507254337	7.39E-08	2.37E-07	mr1039_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251