\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507245949:

Variant ID: vg0507245949 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7245949
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.99, T: 0.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGTACCACTGGGAGAAAATAAGAAGAAGTTGATCTACGAGAGCCGTAGGCACTTGTGGGATGCACCTTACCTTTACAGAGTTTGTTCAGATGGCTTACTA[C/T]
GGAGATGCGTTCCGGCAGATGAAGGCATGCAGATCATTGAGAAGTGTCATGCTGCCCCATATGTAGGTCACTATGGAGCATTCAGGACACACGCAAAGAT

Reverse complement sequence

ATCTTTGCGTGTGTCCTGAATGCTCCATAGTGACCTACATATGGGGCAGCATGACACTTCTCAATGATCTGCATGCCTTCATCTGCCGGAACGCATCTCC[G/A]
TAGTAAGCCATCTGAACAAACTCTGTAAAGGTAAGGTGCATCCCACAAGTGCCTACGGCTCTCGTAGATCAACTTCTTCTTATTTTCTCCCAGTGGTACA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.30% 39.90% 0.04% 0.70% NA
All Indica  2759 61.40% 37.60% 0.04% 0.94% NA
All Japonica  1512 56.30% 43.40% 0.00% 0.33% NA
Aus  269 79.20% 20.80% 0.00% 0.00% NA
Indica I  595 83.40% 16.60% 0.00% 0.00% NA
Indica II  465 27.50% 71.40% 0.22% 0.86% NA
Indica III  913 60.90% 37.80% 0.00% 1.31% NA
Indica Intermediate  786 65.40% 33.30% 0.00% 1.27% NA
Temperate Japonica  767 91.30% 8.70% 0.00% 0.00% NA
Tropical Japonica  504 11.10% 88.30% 0.00% 0.60% NA
Japonica Intermediate  241 39.40% 59.80% 0.00% 0.83% NA
VI/Aromatic  96 3.10% 96.90% 0.00% 0.00% NA
Intermediate  90 47.80% 48.90% 1.11% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507245949 C -> T LOC_Os05g12620.1 missense_variant ; p.Arg875Trp; MODERATE stop_gained Average:52.347; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N
vg0507245949 C -> T LOC_Os05g12620.1 missense_variant ; p.Arg875Trp; MODERATE nonsynonymous_codon ; R875W Average:52.347; most accessible tissue: Minghui63 flag leaf, score: 70.17 probably damaging 3.268 DELETERIOUS 0.00
vg0507245949 C -> DEL LOC_Os05g12620.1 N frameshift_variant Average:52.347; most accessible tissue: Minghui63 flag leaf, score: 70.17 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507245949 NA 8.04E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507245949 NA 4.64E-06 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 NA 9.85E-07 mr1272 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 1.94E-06 2.92E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 2.46E-36 1.46E-68 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 3.15E-27 6.40E-54 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 7.26E-14 5.35E-31 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 NA 3.74E-06 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 NA 7.77E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 NA 6.24E-10 mr1916 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 2.88E-07 NA mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 6.10E-08 1.17E-18 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 NA 3.96E-07 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 NA 2.69E-06 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 7.12E-06 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 3.07E-06 3.46E-10 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 3.86E-42 7.86E-90 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 1.70E-34 9.77E-67 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 1.08E-15 3.64E-41 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 1.71E-07 5.17E-20 mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507245949 1.80E-06 2.51E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251