\
| Variant ID: vg0507223574 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr05 | Position: 7223574 |
| Reference Allele: G | Alternative Allele: A,GGAGGCTT |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 99. )
CGATCTGTGTGAATAAGTGGTTGCGATTGTGGAGGAGAGGATAAGTGTTTGGGATTATATACTACGTATTGAATTTTAGTTCCGGTTGGTAATACCAACC[G/A,GGAGGCTT]
GGACTAAAGTGATCTTTAGTCCCTAAAGATCCTCGGCCCCCTGACATGTCTCTAACAGGGGATGAACCGGGACTAAAGATACCAACTGGGACTAAAGATC
GATCTTTAGTCCCAGTTGGTATCTTTAGTCCCGGTTCATCCCCTGTTAGAGACATGTCAGGGGGCCGAGGATCTTTAGGGACTAAAGATCACTTTAGTCC[C/T,AAGCCTCC]
GGTTGGTATTACCAACCGGAACTAAAATTCAATACGTAGTATATAATCCCAAACACTTATCCTCTCCTCCACAATCGCAACCACTTATTCACACAGATCG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 55.90% | 43.50% | 0.59% | 0.00% | GGAGGCTT: 0.02% |
| All Indica | 2759 | 61.30% | 38.00% | 0.69% | 0.00% | GGAGGCTT: 0.04% |
| All Japonica | 1512 | 56.20% | 43.30% | 0.46% | 0.00% | NA |
| Aus | 269 | 21.90% | 78.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 83.40% | 16.60% | 0.00% | 0.00% | NA |
| Indica II | 465 | 27.30% | 72.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 62.10% | 36.80% | 0.99% | 0.00% | GGAGGCTT: 0.11% |
| Indica Intermediate | 786 | 63.60% | 35.50% | 0.89% | 0.00% | NA |
| Temperate Japonica | 767 | 91.00% | 9.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 11.30% | 88.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 39.40% | 58.50% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 1.00% | 99.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 46.70% | 51.10% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507223574 | G -> GGAGGCTT | LOC_Os05g12580.1 | upstream_gene_variant ; 3680.0bp to feature; MODIFIER | silent_mutation | Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0507223574 | G -> GGAGGCTT | LOC_Os05g12590.1 | upstream_gene_variant ; 4683.0bp to feature; MODIFIER | silent_mutation | Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0507223574 | G -> GGAGGCTT | LOC_Os05g12580-LOC_Os05g12590 | intergenic_region ; MODIFIER | silent_mutation | Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0507223574 | G -> A | LOC_Os05g12580.1 | upstream_gene_variant ; 3679.0bp to feature; MODIFIER | silent_mutation | Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0507223574 | G -> A | LOC_Os05g12590.1 | upstream_gene_variant ; 4684.0bp to feature; MODIFIER | silent_mutation | Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| vg0507223574 | G -> A | LOC_Os05g12580-LOC_Os05g12590 | intergenic_region ; MODIFIER | silent_mutation | Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507223574 | NA | 2.54E-13 | Grain_thickness | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507223574 | 6.12E-07 | NA | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 1.42E-07 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 6.71E-07 | 2.49E-15 | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 9.11E-07 | 2.76E-10 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 1.92E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 4.99E-46 | 2.57E-96 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 3.07E-29 | 2.44E-57 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 5.23E-12 | 5.43E-30 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 9.37E-06 | mr1904 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 7.79E-09 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 9.80E-10 | NA | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 1.69E-08 | 4.02E-20 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 2.02E-06 | mr1268_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 8.36E-07 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 1.93E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 1.75E-07 | NA | mr1531_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 3.35E-06 | 2.50E-10 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 9.01E-52 | 5.15E-113 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 3.94E-35 | 2.01E-70 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 2.26E-16 | 3.26E-42 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 1.75E-08 | mr1627_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | NA | 3.66E-06 | mr1735_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 8.79E-09 | NA | mr1807_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507223574 | 2.75E-07 | 5.62E-12 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |