RiceVarMap2

Search for Variation information by Variation ID:

Detailed information for vg0507223574:

Variant ID: vg0507223574 (JBrowse)	Variation Type: INDEL
Chromosome: chr05	Position: 7223574
Reference Allele: G	Alternative Allele: A,GGAGGCTT
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:

CGATCTGTGTGAATAAGTGGTTGCGATTGTGGAGGAGAGGATAAGTGTTTGGGATTATATACTACGTATTGAATTTTAGTTCCGGTTGGTAATACCAACC[G/A,GGAGGCTT]
GGACTAAAGTGATCTTTAGTCCCTAAAGATCCTCGGCCCCCTGACATGTCTCTAACAGGGGATGAACCGGGACTAAAGATACCAACTGGGACTAAAGATC

Reverse complement sequence

GATCTTTAGTCCCAGTTGGTATCTTTAGTCCCGGTTCATCCCCTGTTAGAGACATGTCAGGGGGCCGAGGATCTTTAGGGACTAAAGATCACTTTAGTCC[C/T,AAGCCTCC]
GGTTGGTATTACCAACCGGAACTAAAATTCAATACGTAGTATATAATCCCAAACACTTATCCTCTCCTCCACAATCGCAACCACTTATTCACACAGATCG

Allele Frequencies:

Search:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.90%	43.50%	0.59%	0.00%	GGAGGCTT: 0.02%
All Indica	2759	61.30%	38.00%	0.69%	0.00%	GGAGGCTT: 0.04%
All Japonica	1512	56.20%	43.30%	0.46%	0.00%	NA
Aus	269	21.90%	78.10%	0.00%	0.00%	NA
Indica I	595	83.40%	16.60%	0.00%	0.00%	NA
Indica II	465	27.30%	72.00%	0.65%	0.00%	NA
Indica III	913	62.10%	36.80%	0.99%	0.00%	GGAGGCTT: 0.11%
Indica Intermediate	786	63.60%	35.50%	0.89%	0.00%	NA
Temperate Japonica	767	91.00%	9.00%	0.00%	0.00%	NA
Tropical Japonica	504	11.30%	88.30%	0.40%	0.00%	NA
Japonica Intermediate	241	39.40%	58.50%	2.07%	0.00%	NA
VI/Aromatic	96	1.00%	99.00%	0.00%	0.00%	NA
Intermediate	90	46.70%	51.10%	2.22%	0.00%	NA

Showing 1 to 13 of 13 entries

Allele Effect:

Search:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507223574	G -> GGAGGCTT	LOC_Os05g12580.1	upstream_gene_variant ; 3680.0bp to feature; MODIFIER	silent_mutation	Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0507223574	G -> GGAGGCTT	LOC_Os05g12590.1	upstream_gene_variant ; 4683.0bp to feature; MODIFIER	silent_mutation	Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0507223574	G -> GGAGGCTT	LOC_Os05g12580-LOC_Os05g12590	intergenic_region ; MODIFIER	silent_mutation	Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0507223574	G -> A	LOC_Os05g12580.1	upstream_gene_variant ; 3679.0bp to feature; MODIFIER	silent_mutation	Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0507223574	G -> A	LOC_Os05g12590.1	upstream_gene_variant ; 4684.0bp to feature; MODIFIER	silent_mutation	Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N
vg0507223574	G -> A	LOC_Os05g12580-LOC_Os05g12590	intergenic_region ; MODIFIER	silent_mutation	Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841	N	N	N	N

Showing 1 to 6 of 6 entries

Putative Genotype-Phenotype Associations:

Show entries

Search:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507223574	NA	2.54E-13	Grain_thickness	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507223574	6.12E-07	NA	mr1195	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	NA	1.42E-07	mr1195	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	6.71E-07	2.49E-15	mr1531	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	9.11E-07	2.76E-10	mr1531	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	NA	1.92E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	4.99E-46	2.57E-96	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	3.07E-29	2.44E-57	mr1593	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	5.23E-12	5.43E-30	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574	NA	9.37E-06	mr1904	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251

Showing 1 to 10 of 25 entries

Previous1 2 3Next

Search for Variation information by Variation ID:

Detailed information for vg0507223574:

Flanking Sequence (100 bp) in Reference Genome:

Reverse complement sequence

Allele Frequencies:

Allele Effect:

Putative Genotype-Phenotype Associations:

RiceVarMap v2.0

Tools

Blast

Design Primer by Variation ID

Design Primer by Region

Haplotype Network Analysis

Varitation Coordinate Convert

Contact