\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507223574:

Variant ID: vg0507223574 (JBrowse)Variation Type: INDEL
Chromosome: chr05Position: 7223574
Reference Allele: GAlternative Allele: A,GGAGGCTT
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.94, A: 0.06, others allele: 0.00, population size: 99. )

Flanking Sequence (100 bp) in Reference Genome:


CGATCTGTGTGAATAAGTGGTTGCGATTGTGGAGGAGAGGATAAGTGTTTGGGATTATATACTACGTATTGAATTTTAGTTCCGGTTGGTAATACCAACC[G/A,GGAGGCTT]
GGACTAAAGTGATCTTTAGTCCCTAAAGATCCTCGGCCCCCTGACATGTCTCTAACAGGGGATGAACCGGGACTAAAGATACCAACTGGGACTAAAGATC

Reverse complement sequence

GATCTTTAGTCCCAGTTGGTATCTTTAGTCCCGGTTCATCCCCTGTTAGAGACATGTCAGGGGGCCGAGGATCTTTAGGGACTAAAGATCACTTTAGTCC[C/T,AAGCCTCC]
GGTTGGTATTACCAACCGGAACTAAAATTCAATACGTAGTATATAATCCCAAACACTTATCCTCTCCTCCACAATCGCAACCACTTATTCACACAGATCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.90% 43.50% 0.59% 0.00% GGAGGCTT: 0.02%
All Indica  2759 61.30% 38.00% 0.69% 0.00% GGAGGCTT: 0.04%
All Japonica  1512 56.20% 43.30% 0.46% 0.00% NA
Aus  269 21.90% 78.10% 0.00% 0.00% NA
Indica I  595 83.40% 16.60% 0.00% 0.00% NA
Indica II  465 27.30% 72.00% 0.65% 0.00% NA
Indica III  913 62.10% 36.80% 0.99% 0.00% GGAGGCTT: 0.11%
Indica Intermediate  786 63.60% 35.50% 0.89% 0.00% NA
Temperate Japonica  767 91.00% 9.00% 0.00% 0.00% NA
Tropical Japonica  504 11.30% 88.30% 0.40% 0.00% NA
Japonica Intermediate  241 39.40% 58.50% 2.07% 0.00% NA
VI/Aromatic  96 1.00% 99.00% 0.00% 0.00% NA
Intermediate  90 46.70% 51.10% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507223574 G -> GGAGGCTT LOC_Os05g12580.1 upstream_gene_variant ; 3680.0bp to feature; MODIFIER silent_mutation Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0507223574 G -> GGAGGCTT LOC_Os05g12590.1 upstream_gene_variant ; 4683.0bp to feature; MODIFIER silent_mutation Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0507223574 G -> GGAGGCTT LOC_Os05g12580-LOC_Os05g12590 intergenic_region ; MODIFIER silent_mutation Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0507223574 G -> A LOC_Os05g12580.1 upstream_gene_variant ; 3679.0bp to feature; MODIFIER silent_mutation Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0507223574 G -> A LOC_Os05g12590.1 upstream_gene_variant ; 4684.0bp to feature; MODIFIER silent_mutation Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N
vg0507223574 G -> A LOC_Os05g12580-LOC_Os05g12590 intergenic_region ; MODIFIER silent_mutation Average:63.528; most accessible tissue: Zhenshan97 young leaf, score: 81.841 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507223574 NA 2.54E-13 Grain_thickness Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507223574 6.12E-07 NA mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 1.42E-07 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 6.71E-07 2.49E-15 mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 9.11E-07 2.76E-10 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 1.92E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 4.99E-46 2.57E-96 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 3.07E-29 2.44E-57 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 5.23E-12 5.43E-30 mr1593 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 9.37E-06 mr1904 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 7.79E-09 mr1916 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 9.80E-10 NA mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 1.69E-08 4.02E-20 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 2.02E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 8.36E-07 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 1.93E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 1.75E-07 NA mr1531_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 3.35E-06 2.50E-10 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 9.01E-52 5.15E-113 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 3.94E-35 2.01E-70 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 2.26E-16 3.26E-42 mr1593_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 1.75E-08 mr1627_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 NA 3.66E-06 mr1735_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 8.79E-09 NA mr1807_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507223574 2.75E-07 5.62E-12 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251