Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0507158546:

Variant ID: vg0507158546 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7158546
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AACCAATATGAAACATTTGTCTTCCTTTAATTTAAAACGAAGGAGGCAAAAAGTAGTAGTTCCCTCCCGGGCAGGTGTGAATATCCTCTTAGCATTACCG[A/G]
TAAGCCGAGCAAGTGTGATCAGCTCTTCTCAAGGATCATGAATGAAGATCCAAATTGCATTCCCATGACTACGCATGGTACTTGAATAATGTAAACAAAA

Reverse complement sequence

TTTTGTTTACATTATTCAAGTACCATGCGTAGTCATGGGAATGCAATTTGGATCTTCATTCATGATCCTTGAGAAGAGCTGATCACACTTGCTCGGCTTA[T/C]
CGGTAATGCTAAGAGGATATTCACACCTGCCCGGGAGGGAACTACTACTTTTTGCCTCCTTCGTTTTAAATTAAAGGAAGACAAATGTTTCATATTGGTT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	85.00%	14.20%	0.80%	0.00%	NA
All Indica	2759	99.50%	0.50%	0.07%	0.00%	NA
All Japonica	1512	55.20%	42.50%	2.38%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.50%	0.50%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	99.60%	0.10%	0.25%	0.00%	NA
Temperate Japonica	767	23.70%	72.20%	4.04%	0.00%	NA
Tropical Japonica	504	93.80%	6.20%	0.00%	0.00%	NA
Japonica Intermediate	241	74.30%	23.70%	2.07%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507158546	A -> G	LOC_Os05g12460.1	3_prime_UTR_variant ; 29.0bp to feature; MODIFIER	silent_mutation	Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0507158546	A -> G	LOC_Os05g12474.1	upstream_gene_variant ; 3082.0bp to feature; MODIFIER	silent_mutation	Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0507158546	A -> G	LOC_Os05g12474.2	upstream_gene_variant ; 3082.0bp to feature; MODIFIER	silent_mutation	Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N
vg0507158546	A -> G	LOC_Os05g12450.1	downstream_gene_variant ; 4604.0bp to feature; MODIFIER	silent_mutation	Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507158546	1.07E-08	1.25E-42	Grain_thickness	All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507158546	NA	3.42E-15	Grain_thickness	Jap_All	YES	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0507158546	NA	6.06E-15	mr1401	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	NA	2.81E-06	mr1401	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	NA	6.30E-07	mr1584	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	3.40E-09	6.66E-12	mr1593	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	9.71E-10	4.56E-19	mr1593	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	NA	1.53E-09	mr1730	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	1.28E-06	1.51E-11	mr1593_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507158546	3.31E-08	5.18E-21	mr1593_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251