\
| Variant ID: vg0507158546 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7158546 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
AACCAATATGAAACATTTGTCTTCCTTTAATTTAAAACGAAGGAGGCAAAAAGTAGTAGTTCCCTCCCGGGCAGGTGTGAATATCCTCTTAGCATTACCG[A/G]
TAAGCCGAGCAAGTGTGATCAGCTCTTCTCAAGGATCATGAATGAAGATCCAAATTGCATTCCCATGACTACGCATGGTACTTGAATAATGTAAACAAAA
TTTTGTTTACATTATTCAAGTACCATGCGTAGTCATGGGAATGCAATTTGGATCTTCATTCATGATCCTTGAGAAGAGCTGATCACACTTGCTCGGCTTA[T/C]
CGGTAATGCTAAGAGGATATTCACACCTGCCCGGGAGGGAACTACTACTTTTTGCCTCCTTCGTTTTAAATTAAAGGAAGACAAATGTTTCATATTGGTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 85.00% | 14.20% | 0.80% | 0.00% | NA |
| All Indica | 2759 | 99.50% | 0.50% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 55.20% | 42.50% | 2.38% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.60% | 0.10% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 23.70% | 72.20% | 4.04% | 0.00% | NA |
| Tropical Japonica | 504 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 74.30% | 23.70% | 2.07% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 15.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507158546 | A -> G | LOC_Os05g12460.1 | 3_prime_UTR_variant ; 29.0bp to feature; MODIFIER | silent_mutation | Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0507158546 | A -> G | LOC_Os05g12474.1 | upstream_gene_variant ; 3082.0bp to feature; MODIFIER | silent_mutation | Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0507158546 | A -> G | LOC_Os05g12474.2 | upstream_gene_variant ; 3082.0bp to feature; MODIFIER | silent_mutation | Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| vg0507158546 | A -> G | LOC_Os05g12450.1 | downstream_gene_variant ; 4604.0bp to feature; MODIFIER | silent_mutation | Average:32.199; most accessible tissue: Zhenshan97 panicle, score: 39.652 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507158546 | 1.07E-08 | 1.25E-42 | Grain_thickness | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507158546 | NA | 3.42E-15 | Grain_thickness | Jap_All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507158546 | NA | 6.06E-15 | mr1401 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | NA | 2.81E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | NA | 6.30E-07 | mr1584 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | 3.40E-09 | 6.66E-12 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | 9.71E-10 | 4.56E-19 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | NA | 1.53E-09 | mr1730 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | 1.28E-06 | 1.51E-11 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507158546 | 3.31E-08 | 5.18E-21 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |