\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507156565:

Variant ID: vg0507156565 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7156565
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.31, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:


TTCAAAAAATTTAAGTAATTATCATTTATTTTATTGTGACTTGATTCGTCATCAAATGTTCTTTAAACATGACATAAATATTTTCATATTTGCACAAAAA[A/T]
TTTAAATAAAATAAAAGGTCAAACGTTAGTTGAAAAGTCAACGACATCGTACATTAAAATATGGAGGGAGTATTTATTTGTTGAAAATGATTGCTTAAAC

Reverse complement sequence

GTTTAAGCAATCATTTTCAACAAATAAATACTCCCTCCATATTTTAATGTACGATGTCGTTGACTTTTCAACTAACGTTTGACCTTTTATTTTATTTAAA[T/A]
TTTTTGTGCAAATATGAAAATATTTATGTCATGTTTAAAGAACATTTGATGACGAATCAAGTCACAATAAAATAAATGATAATTACTTAAATTTTTTGAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 68.00% 28.30% 3.75% 0.00% NA
All Indica  2759 56.20% 37.80% 6.02% 0.00% NA
All Japonica  1512 95.90% 3.70% 0.40% 0.00% NA
Aus  269 20.10% 78.80% 1.12% 0.00% NA
Indica I  595 62.20% 22.00% 15.80% 0.00% NA
Indica II  465 77.20% 20.60% 2.15% 0.00% NA
Indica III  913 49.10% 49.40% 1.53% 0.00% NA
Indica Intermediate  786 47.60% 46.30% 6.11% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 95.40% 4.00% 0.60% 0.00% NA
Japonica Intermediate  241 85.50% 13.70% 0.83% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507156565 A -> T LOC_Os05g12450.1 downstream_gene_variant ; 2623.0bp to feature; MODIFIER silent_mutation Average:43.94; most accessible tissue: Callus, score: 68.486 N N N N
vg0507156565 A -> T LOC_Os05g12460.1 downstream_gene_variant ; 1639.0bp to feature; MODIFIER silent_mutation Average:43.94; most accessible tissue: Callus, score: 68.486 N N N N
vg0507156565 A -> T LOC_Os05g12450-LOC_Os05g12460 intergenic_region ; MODIFIER silent_mutation Average:43.94; most accessible tissue: Callus, score: 68.486 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507156565 9.45E-06 NA mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565 2.37E-07 5.87E-11 mr1593 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565 NA 5.56E-08 mr1133_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565 2.92E-06 1.63E-10 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565 NA 3.51E-06 mr1667_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507156565 NA 1.79E-06 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251