\
| Variant ID: vg0507156565 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7156565 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.70, A: 0.31, others allele: 0.00, population size: 86. )
TTCAAAAAATTTAAGTAATTATCATTTATTTTATTGTGACTTGATTCGTCATCAAATGTTCTTTAAACATGACATAAATATTTTCATATTTGCACAAAAA[A/T]
TTTAAATAAAATAAAAGGTCAAACGTTAGTTGAAAAGTCAACGACATCGTACATTAAAATATGGAGGGAGTATTTATTTGTTGAAAATGATTGCTTAAAC
GTTTAAGCAATCATTTTCAACAAATAAATACTCCCTCCATATTTTAATGTACGATGTCGTTGACTTTTCAACTAACGTTTGACCTTTTATTTTATTTAAA[T/A]
TTTTTGTGCAAATATGAAAATATTTATGTCATGTTTAAAGAACATTTGATGACGAATCAAGTCACAATAAAATAAATGATAATTACTTAAATTTTTTGAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 68.00% | 28.30% | 3.75% | 0.00% | NA |
| All Indica | 2759 | 56.20% | 37.80% | 6.02% | 0.00% | NA |
| All Japonica | 1512 | 95.90% | 3.70% | 0.40% | 0.00% | NA |
| Aus | 269 | 20.10% | 78.80% | 1.12% | 0.00% | NA |
| Indica I | 595 | 62.20% | 22.00% | 15.80% | 0.00% | NA |
| Indica II | 465 | 77.20% | 20.60% | 2.15% | 0.00% | NA |
| Indica III | 913 | 49.10% | 49.40% | 1.53% | 0.00% | NA |
| Indica Intermediate | 786 | 47.60% | 46.30% | 6.11% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.40% | 4.00% | 0.60% | 0.00% | NA |
| Japonica Intermediate | 241 | 85.50% | 13.70% | 0.83% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507156565 | A -> T | LOC_Os05g12450.1 | downstream_gene_variant ; 2623.0bp to feature; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Callus, score: 68.486 | N | N | N | N |
| vg0507156565 | A -> T | LOC_Os05g12460.1 | downstream_gene_variant ; 1639.0bp to feature; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Callus, score: 68.486 | N | N | N | N |
| vg0507156565 | A -> T | LOC_Os05g12450-LOC_Os05g12460 | intergenic_region ; MODIFIER | silent_mutation | Average:43.94; most accessible tissue: Callus, score: 68.486 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507156565 | 9.45E-06 | NA | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507156565 | 2.37E-07 | 5.87E-11 | mr1593 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507156565 | NA | 5.56E-08 | mr1133_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507156565 | 2.92E-06 | 1.63E-10 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507156565 | NA | 3.51E-06 | mr1667_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507156565 | NA | 1.79E-06 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |