\
| Variant ID: vg0507148940 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7148940 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, T: 0.12, others allele: 0.00, population size: 107. )
AAGTTTGGGTTGGCTAGGAAGACCTGGGCCGAAAGCAAATTTGATCAAACAATGTGGCTCATATTTTTTAAATCAAAGTCCGTCGGATAAGCTCCTAAGT[A/T]
GGCTCGAAAAATAAATATAAGACTAAATCATAAATTCTATGCTAATTCATCAAATTAGACTCGGTTCTACCTATTTGTTAATATATCAAATTAGACTTAG
CTAAGTCTAATTTGATATATTAACAAATAGGTAGAACCGAGTCTAATTTGATGAATTAGCATAGAATTTATGATTTAGTCTTATATTTATTTTTCGAGCC[T/A]
ACTTAGGAGCTTATCCGACGGACTTTGATTTAAAAAATATGAGCCACATTGTTTGATCAAATTTGCTTTCGGCCCAGGTCTTCCTAGCCAACCCAAACTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 59.50% | 39.90% | 0.02% | 0.59% | NA |
| All Indica | 2759 | 41.40% | 57.80% | 0.04% | 0.80% | NA |
| All Japonica | 1512 | 95.80% | 3.90% | 0.00% | 0.26% | NA |
| Aus | 269 | 23.40% | 76.60% | 0.00% | 0.00% | NA |
| Indica I | 595 | 18.20% | 81.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 73.80% | 25.20% | 0.22% | 0.86% | NA |
| Indica III | 913 | 42.40% | 56.50% | 0.00% | 1.10% | NA |
| Indica Intermediate | 786 | 38.50% | 60.40% | 0.00% | 1.02% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507148940 | A -> T | LOC_Os05g12450.1 | upstream_gene_variant ; 3391.0bp to feature; MODIFIER | silent_mutation | Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0507148940 | A -> T | LOC_Os05g12430.1 | downstream_gene_variant ; 2313.0bp to feature; MODIFIER | silent_mutation | Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0507148940 | A -> T | LOC_Os05g12440.1 | downstream_gene_variant ; 722.0bp to feature; MODIFIER | silent_mutation | Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0507148940 | A -> T | LOC_Os05g12430-LOC_Os05g12440 | intergenic_region ; MODIFIER | silent_mutation | Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| vg0507148940 | A -> DEL | N | N | silent_mutation | Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507148940 | NA | 1.53E-08 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 1.56E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 9.29E-07 | 2.59E-09 | mr1195 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 1.41E-12 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 1.36E-06 | NA | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 7.98E-08 | 1.15E-11 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 8.15E-30 | 5.80E-29 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 4.28E-39 | 2.95E-68 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 3.45E-12 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 1.81E-10 | 1.67E-32 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 9.24E-12 | 7.69E-23 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 1.48E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 4.10E-10 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 8.02E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 4.69E-09 | NA | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 1.47E-10 | 4.88E-15 | mr1531_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 6.62E-35 | 8.33E-38 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 5.34E-48 | 8.48E-87 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 7.58E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | 3.71E-06 | 8.22E-11 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507148940 | NA | 4.09E-07 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |