\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507148940:

Variant ID: vg0507148940 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7148940
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.88, T: 0.12, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


AAGTTTGGGTTGGCTAGGAAGACCTGGGCCGAAAGCAAATTTGATCAAACAATGTGGCTCATATTTTTTAAATCAAAGTCCGTCGGATAAGCTCCTAAGT[A/T]
GGCTCGAAAAATAAATATAAGACTAAATCATAAATTCTATGCTAATTCATCAAATTAGACTCGGTTCTACCTATTTGTTAATATATCAAATTAGACTTAG

Reverse complement sequence

CTAAGTCTAATTTGATATATTAACAAATAGGTAGAACCGAGTCTAATTTGATGAATTAGCATAGAATTTATGATTTAGTCTTATATTTATTTTTCGAGCC[T/A]
ACTTAGGAGCTTATCCGACGGACTTTGATTTAAAAAATATGAGCCACATTGTTTGATCAAATTTGCTTTCGGCCCAGGTCTTCCTAGCCAACCCAAACTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.50% 39.90% 0.02% 0.59% NA
All Indica  2759 41.40% 57.80% 0.04% 0.80% NA
All Japonica  1512 95.80% 3.90% 0.00% 0.26% NA
Aus  269 23.40% 76.60% 0.00% 0.00% NA
Indica I  595 18.20% 81.80% 0.00% 0.00% NA
Indica II  465 73.80% 25.20% 0.22% 0.86% NA
Indica III  913 42.40% 56.50% 0.00% 1.10% NA
Indica Intermediate  786 38.50% 60.40% 0.00% 1.02% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.20% 0.00% 0.60% NA
Japonica Intermediate  241 85.50% 14.10% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507148940 A -> T LOC_Os05g12450.1 upstream_gene_variant ; 3391.0bp to feature; MODIFIER silent_mutation Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0507148940 A -> T LOC_Os05g12430.1 downstream_gene_variant ; 2313.0bp to feature; MODIFIER silent_mutation Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0507148940 A -> T LOC_Os05g12440.1 downstream_gene_variant ; 722.0bp to feature; MODIFIER silent_mutation Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0507148940 A -> T LOC_Os05g12430-LOC_Os05g12440 intergenic_region ; MODIFIER silent_mutation Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N
vg0507148940 A -> DEL N N silent_mutation Average:57.613; most accessible tissue: Minghui63 young leaf, score: 71.254 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507148940 NA 1.53E-08 mr1050 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 1.56E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 9.29E-07 2.59E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 1.41E-12 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 1.36E-06 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 7.98E-08 1.15E-11 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 8.15E-30 5.80E-29 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 4.28E-39 2.95E-68 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 3.45E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 1.81E-10 1.67E-32 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 9.24E-12 7.69E-23 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 1.48E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 4.10E-10 mr1482_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 8.02E-07 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 4.69E-09 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 1.47E-10 4.88E-15 mr1531_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 6.62E-35 8.33E-38 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 5.34E-48 8.48E-87 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 7.58E-08 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 3.71E-06 8.22E-11 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507148940 NA 4.09E-07 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251