\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507143482:

Variant ID: vg0507143482 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7143482
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.95, T: 0.04, others allele: 0.00, population size: 111. )

Flanking Sequence (100 bp) in Reference Genome:


CGAACCTAAAGACAAGCTTTTTGGACCTGCACTGGAGTTAAGCAGATCTCCCAGGCCTCATGTTTTCTCTTCAACATAGCTCAGTACGGGTATTCCTGCG[C/T]
GCGTGTATATAGTCCTAAGTTAATTTTCTGGGGAGGGTACTCCTCCGTATTTAGCCCCGGTTGTATGGTCATGACGGGCTATCGTAAGGAACTCGGCAGT

Reverse complement sequence

ACTGCCGAGTTCCTTACGATAGCCCGTCATGACCATACAACCGGGGCTAAATACGGAGGAGTACCCTCCCCAGAAAATTAACTTAGGACTATATACACGC[G/A]
CGCAGGAATACCCGTACTGAGCTATGTTGAAGAGAAAACATGAGGCCTGGGAGATCTGCTTAACTCCAGTGCAGGTCCAAAAAGCTTGTCTTTAGGTTCG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 40.50% 0.06% 0.57% NA
All Indica  2759 40.40% 58.70% 0.11% 0.80% NA
All Japonica  1512 95.80% 3.90% 0.00% 0.26% NA
Aus  269 22.70% 77.30% 0.00% 0.00% NA
Indica I  595 18.50% 81.50% 0.00% 0.00% NA
Indica II  465 73.80% 25.20% 0.22% 0.86% NA
Indica III  913 40.60% 58.20% 0.22% 0.99% NA
Indica Intermediate  786 36.90% 62.00% 0.00% 1.15% NA
Temperate Japonica  767 99.50% 0.50% 0.00% 0.00% NA
Tropical Japonica  504 95.20% 4.20% 0.00% 0.60% NA
Japonica Intermediate  241 85.50% 14.10% 0.00% 0.41% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 26.70% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507143482 C -> T LOC_Os05g12430.1 upstream_gene_variant ; 2065.0bp to feature; MODIFIER silent_mutation Average:49.768; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0507143482 C -> T LOC_Os05g12420.1 downstream_gene_variant ; 1141.0bp to feature; MODIFIER silent_mutation Average:49.768; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0507143482 C -> T LOC_Os05g12420-LOC_Os05g12430 intergenic_region ; MODIFIER silent_mutation Average:49.768; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N
vg0507143482 C -> DEL N N silent_mutation Average:49.768; most accessible tissue: Minghui63 flag leaf, score: 79.676 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507143482 NA 2.71E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 3.50E-06 5.76E-09 mr1195 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 1.35E-10 mr1272 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 1.29E-07 NA mr1531 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 1.57E-08 4.71E-12 mr1531 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 1.41E-26 8.34E-27 mr1593 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 2.10E-34 6.87E-65 mr1593 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 1.41E-12 mr1904 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 2.47E-11 1.65E-31 mr1195_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 8.89E-12 9.69E-22 mr1195_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 1.08E-08 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 4.53E-12 mr1482_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 2.52E-08 mr1482_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 4.17E-08 NA mr1531_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 3.03E-09 9.33E-14 mr1531_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 8.66E-29 4.08E-34 mr1593_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 1.67E-38 7.78E-80 mr1593_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 1.04E-09 mr1739_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 3.56E-09 mr1748_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 3.14E-09 mr1807_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 2.12E-14 mr1902_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507143482 NA 5.30E-06 mr1977_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251