\
| Variant ID: vg0507142279 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7142279 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.75, G: 0.25, others allele: 0.00, population size: 241. )
CATGCATGGATTGAGTCCTGAAAAGGCAATTGTATCTATTAATTAGGGTATTTCTTGTAATTTCCTTAGAGATAAGTTTGGGCAAAAGTCTGCCGCAAAG[A/G]
CTTATGGTATCTTAGAGTTTGTTAGAGATGAGAGTCGTGTCCGACATGGACATATTTTGTAATCTCGGGTATAAATAGACCCCGAGCCCCATGTAATACA
TGTATTACATGGGGCTCGGGGTCTATTTATACCCGAGATTACAAAATATGTCCATGTCGGACACGACTCTCATCTCTAACAAACTCTAAGATACCATAAG[T/C]
CTTTGCGGCAGACTTTTGCCCAAACTTATCTCTAAGGAAATTACAAGAAATACCCTAATTAATAGATACAATTGCCTTTTCAGGACTCAATCCATGCATG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.80% | 40.10% | 0.25% | 0.80% | NA |
| All Indica | 2759 | 40.30% | 58.20% | 0.36% | 1.12% | NA |
| All Japonica | 1512 | 95.80% | 3.90% | 0.00% | 0.26% | NA |
| Aus | 269 | 22.70% | 76.60% | 0.37% | 0.37% | NA |
| Indica I | 595 | 18.20% | 81.30% | 0.34% | 0.17% | NA |
| Indica II | 465 | 74.00% | 24.90% | 0.00% | 1.08% | NA |
| Indica III | 913 | 40.60% | 57.50% | 0.44% | 1.42% | NA |
| Indica Intermediate | 786 | 36.90% | 61.10% | 0.51% | 1.53% | NA |
| Temperate Japonica | 767 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 95.20% | 4.20% | 0.00% | 0.60% | NA |
| Japonica Intermediate | 241 | 85.50% | 14.10% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 97.90% | 1.00% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 0.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507142279 | A -> DEL | LOC_Os05g12420.1 | N | frameshift_variant | Average:27.83; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | N | N | N | N |
| vg0507142279 | A -> G | LOC_Os05g12420.1 | missense_variant ; p.Thr243Ala; MODERATE | nonsynonymous_codon ; T243A | Average:27.83; most accessible tissue: Zhenshan97 flag leaf, score: 37.1 | unknown | unknown | DELETERIOUS | 0.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507142279 | NA | 8.32E-09 | mr1050 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 2.06E-11 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 1.23E-07 | 2.44E-10 | mr1195 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 7.76E-12 | mr1272 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 6.00E-07 | NA | mr1531 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 6.74E-08 | 8.50E-12 | mr1531 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 1.14E-27 | 7.75E-30 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 1.32E-42 | 5.74E-75 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 4.56E-12 | mr1904 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 2.41E-10 | 8.39E-33 | mr1195_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 2.35E-12 | 8.26E-24 | mr1195_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 1.52E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 1.17E-10 | mr1482_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 1.29E-07 | mr1482_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 5.39E-09 | NA | mr1531_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 6.08E-10 | 1.05E-14 | mr1531_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 2.64E-30 | 6.92E-38 | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 1.53E-49 | 4.87E-93 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 1.15E-09 | mr1739_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 1.65E-08 | mr1748_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | 8.62E-07 | 3.25E-11 | mr1807_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507142279 | NA | 1.34E-06 | mr1977_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |