\
| Variant ID: vg0507099648 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7099648 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAGACGACTTCACTATGGCAAGTTCGCCCCCGCGAGGGCCGAGGAAGCCTTTCCGGCCCAACAAGCCTAGGGGCTATAGGGCCGGCGATCGCCAGACGGC[C/G]
CATCAGGGGCCCATGAGCCCCTATAATATTATGTACCCCTGTAAATGTCCTTTTCGTAAGGGTAATCATGTAAATTCCCCTGTACAACCTAAACCCTAAT
ATTAGGGTTTAGGTTGTACAGGGGAATTTACATGATTACCCTTACGAAAAGGACATTTACAGGGGTACATAATATTATAGGGGCTCATGGGCCCCTGATG[G/C]
GCCGTCTGGCGATCGCCGGCCCTATAGCCCCTAGGCTTGTTGGGCCGGAAAGGCTTCCTCGGCCCTCGCGGGGGCGAACTTGCCATAGTGAAGTCGTCTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.60% | 30.20% | 0.95% | 36.23% | NA |
| All Indica | 2759 | 52.20% | 11.60% | 1.16% | 35.12% | NA |
| All Japonica | 1512 | 1.10% | 60.80% | 0.40% | 37.70% | NA |
| Aus | 269 | 22.30% | 58.70% | 1.49% | 17.47% | NA |
| Indica I | 595 | 70.60% | 13.80% | 0.67% | 14.96% | NA |
| Indica II | 465 | 26.00% | 5.40% | 1.72% | 66.88% | NA |
| Indica III | 913 | 52.40% | 9.60% | 1.53% | 36.47% | NA |
| Indica Intermediate | 786 | 53.40% | 15.80% | 0.76% | 30.03% | NA |
| Temperate Japonica | 767 | 0.40% | 91.50% | 0.00% | 8.08% | NA |
| Tropical Japonica | 504 | 2.00% | 14.50% | 0.79% | 82.74% | NA |
| Japonica Intermediate | 241 | 1.20% | 60.20% | 0.83% | 37.76% | NA |
| VI/Aromatic | 96 | 2.10% | 5.20% | 2.08% | 90.62% | NA |
| Intermediate | 90 | 25.60% | 30.00% | 1.11% | 43.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507099648 | C -> DEL | N | N | silent_mutation | Average:35.288; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0507099648 | C -> G | LOC_Os05g12350.1 | upstream_gene_variant ; 242.0bp to feature; MODIFIER | silent_mutation | Average:35.288; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0507099648 | C -> G | LOC_Os05g12350-LOC_Os05g12360 | intergenic_region ; MODIFIER | silent_mutation | Average:35.288; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507099648 | NA | 5.93E-12 | mr1593 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507099648 | NA | 2.60E-06 | mr1121_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507099648 | 2.78E-08 | NA | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507099648 | 3.85E-07 | 2.69E-17 | mr1593_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507099648 | NA | 7.18E-06 | mr1892_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |