Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507098360:

Variant ID: vg0507098360 (JBrowse)	Variation Type: SNP
Chromosome: chr05	Position: 7098360
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:

CCGGTTCGGCGCGATCGCCCTGCGCCGGCACCGGAGGGCTTTCGCCGAGTCAGAACCAGCCTCGAAGGGGATGGAGTGATAGAACCACCTAGCCATCCAA[T/A]
GGCGGTCCCACTTCGACATGGCAGCGTTCACCGGCCAGAGATCGGACCGCTCAGGATGAACGTTGAAGTTCACACTCCTGAACTCGGTCTTCTTTGTCCC

Reverse complement sequence

GGGACAAAGAAGACCGAGTTCAGGAGTGTGAACTTCAACGTTCATCCTGAGCGGTCCGATCTCTGGCCGGTGAACGCTGCCATGTCGAAGTGGGACCGCC[A/T]
TTGGATGGCTAGGTGGTTCTATCACTCCATCCCCTTCGAGGCTGGTTCTGACTCGGCGAAAGCCCTCCGGTGCCGGCGCAGGGCGATCGCGCCGAACCGG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	90.20%	5.00%	0.66%	4.17%	NA
All Indica	2759	96.80%	0.10%	0.40%	2.68%	NA
All Japonica	1512	80.60%	12.20%	0.86%	6.35%	NA
Aus	269	98.50%	0.00%	0.37%	1.12%	NA
Indica I	595	96.80%	0.00%	0.50%	2.69%	NA
Indica II	465	94.60%	0.90%	0.86%	3.66%	NA
Indica III	913	98.60%	0.00%	0.00%	1.42%	NA
Indica Intermediate	786	95.90%	0.00%	0.51%	3.56%	NA
Temperate Japonica	767	94.50%	0.30%	0.13%	5.08%	NA
Tropical Japonica	504	57.90%	32.90%	2.18%	6.94%	NA
Japonica Intermediate	241	83.40%	7.10%	0.41%	9.13%	NA
VI/Aromatic	96	29.20%	45.80%	6.25%	18.75%	NA
Intermediate	90	91.10%	2.20%	0.00%	6.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0507098360	T -> DEL	LOC_Os05g12350.1	N	frameshift_variant	Average:57.329; most accessible tissue: Minghui63 flag leaf, score: 89.325	N	N	N	N
vg0507098360	T -> A	LOC_Os05g12350.1	missense_variant ; p.His128Leu; MODERATE	nonsynonymous_codon ; H128L	Average:57.329; most accessible tissue: Minghui63 flag leaf, score: 89.325	possibly damaging	1.713	DELETERIOUS	0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0507098360	T	A	0.0	-0.01	-0.01	-0.01	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0507098360	8.72E-07	NA	mr1902	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507098360	NA	5.35E-06	mr1174_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507098360	NA	2.34E-07	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251