\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0507098360:

Variant ID: vg0507098360 (JBrowse)Variation Type: SNP
Chromosome: chr05Position: 7098360
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 300. )

Flanking Sequence (100 bp) in Reference Genome:


CCGGTTCGGCGCGATCGCCCTGCGCCGGCACCGGAGGGCTTTCGCCGAGTCAGAACCAGCCTCGAAGGGGATGGAGTGATAGAACCACCTAGCCATCCAA[T/A]
GGCGGTCCCACTTCGACATGGCAGCGTTCACCGGCCAGAGATCGGACCGCTCAGGATGAACGTTGAAGTTCACACTCCTGAACTCGGTCTTCTTTGTCCC

Reverse complement sequence

GGGACAAAGAAGACCGAGTTCAGGAGTGTGAACTTCAACGTTCATCCTGAGCGGTCCGATCTCTGGCCGGTGAACGCTGCCATGTCGAAGTGGGACCGCC[A/T]
TTGGATGGCTAGGTGGTTCTATCACTCCATCCCCTTCGAGGCTGGTTCTGACTCGGCGAAAGCCCTCCGGTGCCGGCGCAGGGCGATCGCGCCGAACCGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.20% 5.00% 0.66% 4.17% NA
All Indica  2759 96.80% 0.10% 0.40% 2.68% NA
All Japonica  1512 80.60% 12.20% 0.86% 6.35% NA
Aus  269 98.50% 0.00% 0.37% 1.12% NA
Indica I  595 96.80% 0.00% 0.50% 2.69% NA
Indica II  465 94.60% 0.90% 0.86% 3.66% NA
Indica III  913 98.60% 0.00% 0.00% 1.42% NA
Indica Intermediate  786 95.90% 0.00% 0.51% 3.56% NA
Temperate Japonica  767 94.50% 0.30% 0.13% 5.08% NA
Tropical Japonica  504 57.90% 32.90% 2.18% 6.94% NA
Japonica Intermediate  241 83.40% 7.10% 0.41% 9.13% NA
VI/Aromatic  96 29.20% 45.80% 6.25% 18.75% NA
Intermediate  90 91.10% 2.20% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0507098360 T -> DEL LOC_Os05g12350.1 N frameshift_variant Average:57.329; most accessible tissue: Minghui63 flag leaf, score: 89.325 N N N N
vg0507098360 T -> A LOC_Os05g12350.1 missense_variant ; p.His128Leu; MODERATE nonsynonymous_codon ; H128L Average:57.329; most accessible tissue: Minghui63 flag leaf, score: 89.325 possibly damaging 1.713 DELETERIOUS 0.00

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0507098360 T A 0.0 -0.01 -0.01 -0.01 -0.01 -0.01

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0507098360 8.72E-07 NA mr1902 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507098360 NA 5.35E-06 mr1174_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0507098360 NA 2.34E-07 mr1277_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251