\
| Variant ID: vg0507092737 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7092737 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 218. )
CTCCTTCGAAGCAAAAGAAGAAGGAATGAAGAGGTATCTGGAGGCTGTTCGGTTCATGGAAAAATACTTCACTGGCATAACGGTCGAACACTTACCTAGA[A/G]
GCCAGAACGAGGAAGCAGACGCCCTGGCGAAATCCGCTGCTTGTGGTGGCCCACATTCGCCTGGCATCTTTTTCGAAGTCCTACATGCTCCAAGTGTGTC
GACACACTTGGAGCATGTAGGACTTCGAAAAAGATGCCAGGCGAATGTGGGCCACCACAAGCAGCGGATTTCGCCAGGGCGTCTGCTTCCTCGTTCTGGC[T/C]
TCTAGGTAAGTGTTCGACCGTTATGCCAGTGAAGTATTTTTCCATGAACCGAACAGCCTCCAGATACCTCTTCATTCCTTCTTCTTTTGCTTCGAAGGAG
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 19.20% | 13.54% | 20.04% | NA |
| All Indica | 2759 | 67.30% | 1.10% | 17.65% | 13.99% | NA |
| All Japonica | 1512 | 6.70% | 56.70% | 5.95% | 30.62% | NA |
| Aus | 269 | 86.20% | 0.40% | 9.67% | 3.72% | NA |
| Indica I | 595 | 84.50% | 1.00% | 6.72% | 7.73% | NA |
| Indica II | 465 | 41.70% | 2.40% | 31.40% | 24.52% | NA |
| Indica III | 913 | 64.20% | 0.40% | 20.48% | 14.90% | NA |
| Indica Intermediate | 786 | 72.90% | 1.10% | 14.50% | 11.45% | NA |
| Temperate Japonica | 767 | 0.90% | 91.30% | 0.78% | 7.04% | NA |
| Tropical Japonica | 504 | 11.10% | 9.70% | 14.48% | 64.68% | NA |
| Japonica Intermediate | 241 | 15.80% | 45.20% | 4.56% | 34.44% | NA |
| VI/Aromatic | 96 | 8.30% | 1.00% | 20.83% | 69.79% | NA |
| Intermediate | 90 | 38.90% | 18.90% | 18.89% | 23.33% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507092737 | A -> DEL | LOC_Os05g12340.1 | N | frameshift_variant | Average:38.531; most accessible tissue: Minghui63 flag leaf, score: 68.675 | N | N | N | N |
| vg0507092737 | A -> G | LOC_Os05g12340.1 | missense_variant ; p.Ser677Gly; MODERATE | nonsynonymous_codon ; S677G | Average:38.531; most accessible tissue: Minghui63 flag leaf, score: 68.675 | benign |
-0.806 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507092737 | NA | 7.82E-39 | Grain_thickness | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0507092737 | NA | 1.41E-06 | mr1401 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 1.24E-08 | mr1549 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 3.16E-08 | mr1552 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | 2.33E-08 | 5.95E-11 | mr1593 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | 2.32E-10 | 2.26E-26 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 2.17E-07 | mr1723 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | 5.42E-07 | NA | mr1829 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 1.04E-07 | mr1916 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 4.34E-30 | mr1980 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 5.52E-06 | mr1039_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | NA | 5.38E-10 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | 5.26E-06 | NA | mr1593_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507092737 | 5.92E-16 | 1.55E-39 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |