\
| Variant ID: vg0507091279 (JBrowse) | Variation Type: SNP |
| Chromosome: chr05 | Position: 7091279 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.80, C: 0.20, others allele: 0.00, population size: 35. )
CGCAAGATGTCTGCCGACCGCCAAGAAGCGGCGAAAGCCGAGGTACAAAAATTGCTCAGGGCAGGGGTAATCCAAGAGATTGACCATCCGGAGTGGTTGG[T/C]
GAATCCAGTGTTGGTGCGGAAGTCAAATGGCAAATGGCGCATGTGTGTCGATTTCTCAGACCTAAACAAAGCGTATCCGAAAGACGACTTCCCCTTGCCA
TGGCAAGGGGAAGTCGTCTTTCGGATACGCTTTGTTTAGGTCTGAGAAATCGACACACATGCGCCATTTGCCATTTGACTTCCGCACCAACACTGGATTC[A/G]
CCAACCACTCCGGATGGTCAATCTCTTGGATTACCCCTGCCCTGAGCAATTTTTGTACCTCGGCTTTCGCCGCTTCTTGGCGGTCGGCAGACATCTTGCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 32.00% | 25.50% | 9.94% | 32.61% | NA |
| All Indica | 2759 | 50.30% | 7.60% | 11.34% | 30.77% | NA |
| All Japonica | 1512 | 2.60% | 57.30% | 3.77% | 36.24% | NA |
| Aus | 269 | 23.40% | 33.80% | 34.20% | 8.55% | NA |
| Indica I | 595 | 69.40% | 3.70% | 12.61% | 14.29% | NA |
| Indica II | 465 | 21.70% | 15.10% | 8.60% | 54.62% | NA |
| Indica III | 913 | 51.20% | 6.10% | 8.65% | 34.06% | NA |
| Indica Intermediate | 786 | 51.80% | 7.80% | 15.14% | 25.32% | NA |
| Temperate Japonica | 767 | 0.50% | 91.70% | 0.26% | 7.56% | NA |
| Tropical Japonica | 504 | 1.80% | 10.50% | 8.93% | 78.77% | NA |
| Japonica Intermediate | 241 | 11.20% | 46.10% | 4.15% | 38.59% | NA |
| VI/Aromatic | 96 | 0.00% | 7.30% | 3.12% | 89.58% | NA |
| Intermediate | 90 | 23.30% | 32.20% | 5.56% | 38.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0507091279 | T -> DEL | LOC_Os05g12340.1 | N | frameshift_variant | Average:20.854; most accessible tissue: Minghui63 panicle, score: 34.226 | N | N | N | N |
| vg0507091279 | T -> C | LOC_Os05g12340.1 | missense_variant ; p.Val239Ala; MODERATE | nonsynonymous_codon ; V239A | Average:20.854; most accessible tissue: Minghui63 panicle, score: 34.226 | benign |
-0.593 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0507091279 | NA | 8.06E-09 | mr1555 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 8.50E-17 | mr1593 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 5.96E-07 | mr1763 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 2.75E-06 | mr1091_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 5.13E-11 | mr1093_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 5.96E-10 | mr1235_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 3.04E-06 | mr1243_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 3.59E-09 | mr1251_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 7.98E-08 | mr1423_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | NA | 3.85E-09 | mr1435_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0507091279 | 7.14E-06 | 5.75E-23 | mr1593_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |